CN188818

Overview
NameCN188818
Unique NameCN188818
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length161
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS05_0006N02_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0006N02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188818 ID=CN188818|Name=CN188818|organism=Citrus sinensis|type=EST|length=161bp
AGGATTGAACAATGCCTGTGCAAGTTACTAACAAAGATTCTGTATCGTCG
CTCGTGTATAGCGTTGTGAAGGTGATAGATCAGTTTCTTTTAATGTAGAG
GGGCACTGCAATTAATCATCTGAAAAACATTTCAGTTATTGGGGGAAAAA
AAAAAAAAAAA
back to top