CN188814

Overview
NameCN188814
Unique NameCN188814
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length719
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CN188814_ssr522 microsatellite CN188814_ssr522:522..536. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig2792 contig Csv1_Contig2792:59..778. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0006M23_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0006M23, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188814 ID=CN188814|Name=CN188814|organism=Citrus sinensis|type=EST|length=719bp
GCGGTATTGATTTTCCCCTGTTTTTGCTCTCTTTAATAACCCTTTTTATA
TATTTGTAGAGATTAGGGATATACAAAGAAAAGATACCACATTCGTCCCG
GATCATACATAAATTTTCTGTTTTCTCGTGAATTAGTGTCTGAGATGGAG
AACAATCAGCAGTCGTTTTGGCAATTCAGTGATCAACTGAGGGTGCAAGC
ATCAAACTTGGCTAATCTGTCACTCAACGACTCGATCTGGAGCAACAATT
ATGGGTCGAAGAGGCCGGATGAAAGGAGGAATTTCGACATCAGAGTCGGC
GGTCAAGTGAATGTGAATCCATTCACTAAAGGGTCTGATTTGAACGCCTT
CGATGATGGTTACAAGAGTATGAGCAGCAACTACAACGATATTGGCCTAG
GCCCTATCGGCCAGATTATGGCCCCTGCCTCGGCCTCTCAAAAGAATGTT
GGGATCAACGGTGGATTCAACAAAGGGATTTATTCAAAGCCAGGTCATTT
TGGTCTTAGCACCATCAACACCAACAACAACAACAACATCAACAGTTATA
TGAATGTTAATTTGAAGGGGAATAGGAATAGGGAAGAGAATGATCATCAT
GGACTTGGAAGCAAGAGTGGCAAGAAGAACAGCAACAAGAAGAACAATAA
CAAAGATGGTGACAATAATTCCGATAATAAAGACACTAAGACTGCTGCTG
ATAAGAGGTTCAAGACTCT
back to top