CN188798

Overview
NameCN188798
Unique NameCN188798
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length666
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS05_0006M15_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0006M15, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188798 ID=CN188798|Name=CN188798|organism=Citrus sinensis|type=EST|length=666bp
TTTACAGCTACTGCTTCAGTTACATCAACTGCAAGAGAACACAAAAATGA
AGGCGGTACTGAATCTGTTGTCCATAAGGCAGAGGATGTTGTAAGCACCA
TGCTGGCCAAGGGCTTTATTCTGGGCAAAGATGCTGTCGGGAAAGCAAAG
GCCTTTGATGAGAAGCATCGGTTCACTTCTACTGCCACAGCCACAGTGGC
TTCTCTGGATCAGAAGATTGGTTTCACTGAGAAAATAAGCGCAGGAACCA
CACTTGTCAATGACAAAGTGAGGGAAATGGATGAAAAGTTTCATGTTTCT
GAGAAGACCAAGTCTGCCTTTTCAGCTGCCGAGCAGACAGTGAGTAATGC
AGGATCTGCCATCATGAAGAATCGTTATGTGCTGACTGGGGCTTCTTGGG
TTACTGGTGCATTTAATCGGGTTACAAAGGCAGCAGGGGAAGTGAGTGAG
AAGACTAGAGAAAAAGTTCTGGCTGAAGAGGAAGAGACTCGAAAAGCAGA
CGGCTACTCTCAGGTTAGTGATACCGAGTTTCCAAGATCTGCTGCAAATT
AGGAACTTGCAGCTCTTGGTGCTGAAGATCAATCAATACTTTGGTATTTT
AAATGCTATGTAAATATCTTCATAAAGAGAGTGAATATTATCATTTGAAG
AATCTTTAAGTATTGG
back to top