CN181494

Overview
NameCN181494
Unique NameCN181494
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length698
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2471 contig Csv1_Contig2471:928..1626. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of CN181494 vs. ExPASy Swiss-Prot
Match: ERG19_DANRE (Diphosphomevalonate decarboxylase OS=Danio rerio GN=mvd PE=2 SV=1)

HSP 1 Score: 102.834 bits (255), Expect = 1.799e-21
Identity = 61/155 (39.35%), Postives = 86/155 (55.48%), Query Frame = -3
Query:  232 NQFHAVCLDTSPPIFYMNDTSHRIISYVERWNRSVGSPQVAYTFDAGPNAVLIARNRKIATELLQRLLFFFPPNSETDLNSYVLGDKSILRDAGIDGMKDIEALPLPPEINNISAQKYSGDVNYFICTRPGGGPVLLSDDSKALLNPKSGLPKEA 696
            NQFHA+CLDT PPIFY+N+ SH+IIS V R+N+  G  +VAYTFDAGPNAV+ +  +    E ++ +  FFPP  E +   +  G      D   + ++DI   P P              + Y I T+ G GP ++ D +  LL    GLPK++
Sbjct:  260 NQFHAICLDTYPPIFYLNNISHQIISLVHRYNQYYGETRVAYTFDAGPNAVIYSL-QDYLPEFVEVVRHFFPP--EVNEEEFFKGLPVCPADLSEEMIRDINMKPTP------------NGIRYMISTKAGPGPRVVEDPNLHLLG-ADGLPKKS 398          
BLAST of CN181494 vs. ExPASy Swiss-Prot
Match: ERG19_BOVIN (Diphosphomevalonate decarboxylase OS=Bos taurus GN=MVD PE=2 SV=1)

HSP 1 Score: 100.908 bits (250), Expect = 6.836e-21
Identity = 62/155 (40.00%), Postives = 81/155 (52.26%), Query Frame = -3
Query:  232 NQFHAVCLDTSPPIFYMNDTSHRIISYVERWNRSVGSPQVAYTFDAGPNAVLIARNRKIATELLQRLLFFFPPNSETDLNSYVLGDKSILRDAGIDGMKDIEALPLPPEINNISAQKYSGDVNYFICTRPGGGPVLLSDDSKALLNPKSGLPKEA 696
            NQFHA CLDT PPI Y++DTS RII  V R+N   G  +VAYTFDAGPNAV+   +  +A E +  +   FPP S  D     L  + +L    +  +  ++ +P              G + Y I T+ G GP +L D    LL P  GLPK A
Sbjct:  261 NQFHATCLDTFPPISYLSDTSRRIIQLVHRFNAHHGQTKVAYTFDAGPNAVVFTLDDTVA-EFVAAVRHSFPPESNGDKFLKGLPVEPVLLSDELKAVLGMDPVP--------------GSIRYIIATQVGPGPQVLDDPGAHLLGP-DGLPKPA 399          
BLAST of CN181494 vs. ExPASy Swiss-Prot
Match: ERG19_RAT (Diphosphomevalonate decarboxylase OS=Rattus norvegicus GN=Mvd PE=2 SV=1)

HSP 1 Score: 98.5969 bits (244), Expect = 3.393e-20
Identity = 64/156 (41.03%), Postives = 83/156 (53.21%), Query Frame = -3
Query:  238 NQFHAVCLDTSPPIFYMNDTSHRIISYVERWNRSVGSPQVAYTFDAGPNAVLIARNRKIATELLQRLLFFFPPNSETDLNSYVLGDKSILRDAGIDGMKDIEALP--LPPEI-NNISAQKYSGDVNYFICTRPGGGPVLLSDDSKALLNPKSGLPK 696
            NQFHA CLDT PPI Y+NDTS RII  V R+N   G  +VAYTFDAGPNAV+      +A E +  +   FPP +         GDK          +K ++  P  L  E+  +++ +   G V Y I T+ G GP +L D    LL P  GLP+
Sbjct:  262 NQFHATCLDTFPPISYLNDTSRRIIQLVHRFNAHHGQTKVAYTFDAGPNAVIFTLEDTVA-EFVAAVRHSFPPAAN--------GDKF---------LKGLQVAPVLLSDELKTSLATEPSPGGVQYIIATQVGPGPQVLDDPHHHLLGP-DGLPQ 398          
BLAST of CN181494 vs. ExPASy Swiss-Prot
Match: ERG19_HUMAN (Diphosphomevalonate decarboxylase OS=Homo sapiens GN=MVD PE=1 SV=1)

HSP 1 Score: 96.2857 bits (238), Expect = 1.684e-19
Identity = 63/156 (40.38%), Postives = 81/156 (51.92%), Query Frame = -3
Query:  232 NQFHAVCLDTSPPIFYMNDTSHRIISYVERWNRSVGSPQVAYTFDAGPNAVLIARNRKIATELLQRLLFFFPPNSETDLNSYVLGDKSILRDAGIDGMKDIEALPLPPEIN-NISAQKYSGDVNYFICTRPGGGPVLLSDDSKALLNPKSGLPKEA 696
            NQFHA CLDT PPI Y+N  S RII  V R+N   G  +VAYTFDAGPNAV+   +  +A E +  +   FPP S  D  +++ G               +   PL  E+   ++ +   G V Y I T+ G GP +L D    LL P  GLPK A
Sbjct:  261 NQFHATCLDTFPPISYLNAISWRIIHLVHRFNAHHGDTKVAYTFDAGPNAVIFTLDDTVA-EFVAAVWHGFPPGSNGD--TFLKG-------------LQVRPAPLSAELQAALAMEPTPGGVKYIIVTQVGPGPQILDDPCAHLLGP-DGLPKPA 399          
BLAST of CN181494 vs. ExPASy Swiss-Prot
Match: ERG19_MOUSE (Diphosphomevalonate decarboxylase OS=Mus musculus GN=Mvd PE=1 SV=2)

HSP 1 Score: 95.5153 bits (236), Expect = 2.872e-19
Identity = 63/156 (40.38%), Postives = 82/156 (52.56%), Query Frame = -3
Query:  238 NQFHAVCLDTSPPIFYMNDTSHRIISYVERWNRSVGSPQVAYTFDAGPNAVLIARNRKIATELLQRLLFFFPPNSETDLNSYVLGDKSILRDAGIDGMKDIEALP--LPPEIN-NISAQKYSGDVNYFICTRPGGGPVLLSDDSKALLNPKSGLPK 696
            NQFHA CLDT PPI Y+NDTS RII  V R+N   G  +VAYTFDAGPNAV+      +A E +  +   FPP +         GDK          +K ++  P  L  E+   ++ +   G V Y I T+ G GP +L D    LL  + GLP+
Sbjct:  262 NQFHATCLDTFPPISYLNDTSRRIIQLVHRFNTHQGQTKVAYTFDAGPNAVIFTLEDTVA-EFVAAVRHSFPPAAN--------GDKF---------LKGLQVAPVLLSDELKAALAVEPSPGGVQYIIATQVGPGPQVLDDTHDHLLG-QDGLPQ 398          
BLAST of CN181494 vs. ExPASy Swiss-Prot
Match: ERG19_YEAST (Diphosphomevalonate decarboxylase OS=Saccharomyces cerevisiae GN=ERG19 PE=1 SV=2)

HSP 1 Score: 86.2705 bits (212), Expect = 1.742e-16
Identity = 61/160 (38.12%), Postives = 81/160 (50.62%), Query Frame = -3
Query:  235 NQFHAVCLDTSPPIFYMNDTSHRIISYVERWNRSVGSPQVAYTFDAGPNAVL--IARNRKIATELLQRLLFFFPPNSETDLNSYVLGDKSILRDAGIDGMKDIEALPLPPEINNISAQ----KYSGDVNYFICTRPGGGPVLLSDDSKALLNPKSGLPKE 696
            N FHA CLD+ PPIFYMNDTS RIIS+    N+  G   VAYTFDAGPNAVL  +A N       + +L    P             DK    +        +EA     E +N +A+    +   DV   I T+ G GP    + +++L++ K+GLPKE
Sbjct:  258 NSFHATCLDSFPPIFYMNDTSKRIISWCHTINQFYGETIVAYTFDAGPNAVLYYLAENESKLFAFIYKLFGSVPG-----------WDKKFTTE-------QLEAFNHQFESSNFTARELDLELQKDVARVILTQVGSGP---QETNESLIDAKTGLPKE 396          
BLAST of CN181494 vs. ExPASy Swiss-Prot
Match: ERG19_DICDI (Diphosphomevalonate decarboxylase OS=Dictyostelium discoideum GN=mvd PE=3 SV=1)

HSP 1 Score: 85.8853 bits (211), Expect = 2.276e-16
Identity = 56/156 (35.90%), Postives = 88/156 (56.41%), Query Frame = -3
Query:  235 NQFHAVCLDTSPPIFYMNDTSHRIISYVERWNRSVGSPQVAYTFDAGPNAVLIARNRKIATELLQRLLFFFPPNSETDLNSYVLGDKSILRDAGIDGMKDIEALP--LPPEINNISAQKYSGDVNYFICTRPGGGPVLLSDDSKALLNPKSGLPKE 696
            + FH VC  T+PPI+Y+NDTS  I++ + R+N+  GS + AYTFDAGPNA  I    +  TE+L   +  FP +   D+ +Y  G K  +    I+     E L     P+   +++ K      Y + T+ G GP +LS +S++L++  +GLPK+
Sbjct:  247 DDFHEVCATTTPPIYYLNDTSRYIMNLIHRYNKLSGSIKCAYTFDAGPNA-CIYLPAESTTEVLSLFMKHFPGD---DMQTYYRGPKENI--PSIENFVPSEKLASLYTPDTTFVNSLK------YILHTKVGPGPQILS-ESESLIDNTTGLPKQ 389          
BLAST of CN181494 vs. ExPASy Swiss-Prot
Match: ERG19_SCHPO (Diphosphomevalonate decarboxylase OS=Schizosaccharomyces pombe GN=erg19 PE=2 SV=1)

HSP 1 Score: 84.7297 bits (208), Expect = 5.070e-16
Identity = 58/153 (37.91%), Postives = 74/153 (48.37%), Query Frame = -3
Query:  238 NQFHAVCLDTSPPIFYMNDTSHRIISYVERWNRSVGSPQVAYTFDAGPNAVLIARNRKIATELLQRLLFFFPPNSETDLNSYVLGDKSILRDAGIDGMKDIEALPLPPEINNISAQKYSGDVNYFICTRPGGGPVLLSDDSKALLNPKSGLPK 696
            NQFHA CLDT PPIFY+NDTS  +I  VE  N + G    AYTFDAGPNAV                ++F   NSE  LN+     K+    +   G         P  +++ +A   S  ++  I TR G GP +L+ D    L   SG PK
Sbjct:  261 NQFHACCLDTFPPIFYLNDTSRAVIRVVENINATAGKTIAAYTFDAGPNAV----------------IYFLEENSEIVLNTLYAVTKNAEGWSKQYGSS-------PVTVDSAAANIVSSGISRVILTRVGNGPRVLTIDES--LIDASGNPK 388          
BLAST of CN181494 vs. ExPASy Swiss-Prot
Match: ERG19_DEBHA (Diphosphomevalonate decarboxylase OS=Debaryomyces hansenii GN=ERG19 PE=3 SV=2)

HSP 1 Score: 78.9518 bits (193), Expect = 2.782e-14
Identity = 57/153 (37.25%), Postives = 75/153 (49.02%), Query Frame = -3
Query:  238 NQFHAVCLDTSPPIFYMNDTSHRIISYVERWNRSVGSPQVAYTFDAGPNAVLIARNRKIATELLQRLLFFFPPNSETDLNSYVLGDKSILRDAGIDGMKDIEALPLPPEINNISAQKYSGDVNYFICTRPGGGPVLLSDDSKALLNPKSGLPK 696
            N FHAVCLD++PPIFY+NDTS +II  +   N+  G    AYTFDAGPNAV+       +  L     +F   +    L++  L           D   DI+A P          + Y G V+  I T  G GP      S++L+N K GLPK
Sbjct:  258 NSFHAVCLDSTPPIFYLNDTSKKIIKLIHELNKREGKIIAAYTFDAGPNAVIYYEQENESKVLGVIYKYFSKVSGWEKLDTKTL-----------DTTSDIQADP----------ELYKG-VSKIILTEVGQGP---QGSSESLINDK-GLPK 384          
BLAST of CN181494 vs. ExPASy Swiss-Prot
Match: ERG19_ASHGO (Diphosphomevalonate decarboxylase OS=Ashbya gossypii GN=ERG19 PE=3 SV=1)

HSP 1 Score: 73.559 bits (179), Expect = 1.169e-12
Identity = 56/155 (36.13%), Postives = 73/155 (47.10%), Query Frame = -3
Query:  238 NQFHAVCLDTSPPIFYMNDTSHRIISYVERWNRSVGSPQVAYTFDAGPNAVL--IARNRKIATELLQRLLFFFPPNSETDLNSYVLGDKSILRDAGIDGMKDIEALPLPPEINNISAQKYSGDVNYFICTRPGGGPVLLSDDSKALLNPKSGLPK 696
            N FHA CLD+ PPIFYMNDTS RI+      N       VAYTFDAGPNAVL  +A N       L   +F      ET  ++      +   D  + G     A  L  E++          V   I T+ G GP    D   +L++P++GLP+
Sbjct:  233 NSFHATCLDSFPPIFYMNDTSRRIVKLCHLINEFYNETIVAYTFDAGPNAVLYYLAENEARLCGFLS-AVFGANDGWETTFSTEQRATFAAQFDECVRGKL---ATDLDDELHR--------GVARLIFTKVGPGP---QDTKSSLIDPETGLPR 372          
The following BLAST results are available for this feature:
BLAST of CN181494 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 10
Match NameE-valueIdentityDescription
ERG19_DANRE1.799e-2139.35Diphosphomevalonate decarboxylase OS=Danio rerio G... [more]
ERG19_BOVIN6.836e-2140.00Diphosphomevalonate decarboxylase OS=Bos taurus GN... [more]
ERG19_RAT3.393e-2041.03Diphosphomevalonate decarboxylase OS=Rattus norveg... [more]
ERG19_HUMAN1.684e-1940.38Diphosphomevalonate decarboxylase OS=Homo sapiens ... [more]
ERG19_MOUSE2.872e-1940.38Diphosphomevalonate decarboxylase OS=Mus musculus ... [more]
ERG19_YEAST1.742e-1638.13Diphosphomevalonate decarboxylase OS=Saccharomyces... [more]
ERG19_DICDI2.276e-1635.90Diphosphomevalonate decarboxylase OS=Dictyostelium... [more]
ERG19_SCHPO5.070e-1637.91Diphosphomevalonate decarboxylase OS=Schizosacchar... [more]
ERG19_DEBHA2.782e-1437.25Diphosphomevalonate decarboxylase OS=Debaryomyces ... [more]
ERG19_ASHGO1.169e-1236.13Diphosphomevalonate decarboxylase OS=Ashbya gossyp... [more]
back to top
Libraries
Library NameType
Ruby Orange Developing Flower cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS04_0001A13_f Ruby Orange Developing Flower cDNA Library Citrus sinensis cDNA clone CS_REb0001A13, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN181494 ID=CN181494|Name=CN181494|organism=Citrus sinensis|type=EST|length=698bp
GACAACTTATTCATTATTTGTTTCAAGAGGACGAGTCCGTGATCCCCCAA
TGGATTAAAGGGGAAAGGAAATAAATTACAAAAACAACTATAAATTCGGA
AGGAAAGTTCAGAAATTCGCTTCAAGGAAACCTCCATTTAAGTTGTAATG
ATCATCTGAATGAAATACTTGAGGTTCATGGAAATATTTGACTTGCTGGA
GAATAAGCAAAGTGAAAATTAATCTACTCTAAGCTTCCTTAGGCAAACCA
CTTTTGGGGTTGAGAAGAGCCTTACTGTCATCAGAAAGCAAAACAGGACC
TCCACCTGGTCTTGTACAGATAAAATAATTGACATCCCCTGAATATTTCT
GCGCTGATATGTTGTTAATTTCAGGAGGTAGTGGCAAAGCTTCTATATCT
TTCATCCCATCAATACCAGCATCACGTAGGATTGATTTATCACCAAGAAC
ATAACTGTTCAGGTCTGTTTCTGAGTTTGGTGGGAAAAAGAAAAGTAGCC
TCTGAAGCAATTCGGTAGCAATCTTTCTATTACGAGCGATCAGAACAGCA
TTAGGCCCAGCATCAAAAGTATATGCCACCTGAGGTGATCCCACGGAACG
ATTCCATCTTTCAACATAGCTGATAATTCTGTGGGATGTATCATTCATGT
AAAATATTGGGGGAGATGTATCCAAGCAAACCGCATGAAATTGATTAC
back to top