CN181491

Overview
NameCN181491
Unique NameCN181491
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length625
Alignments
Feature NameTypeLocationAnalysis
CN181491_ssr433 microsatellite CN181491_ssr433:433..444.
Csv1_Contig11492 contig Csv1_Contig11492:30..654. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Ruby Orange Developing Flower cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS04_0001A11_r Ruby Orange Developing Flower cDNA Library Citrus sinensis cDNA clone CS_REb0001A11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN181491 ID=CN181491|Name=CN181491|organism=Citrus sinensis|type=EST|length=625bp
GAGGCTCAAGCAAGAAAAAGAAAAATGGGTTCCAAATTGTTCCTTCTTTT
AGGCCTTTTAATGGCCATTGCTCTTCTTATCTCTTCCGAGGTAGCAGCCA
GAGACCTGGCCGAGACTTCCATTGATCACAACGAAAAGGCTGATAAGGCC
ACAGAGACACATGAAATTGAGGACGGTCGCGGCGGATACGGCGGCGGTGG
TGGGGGCTATGGCGGTGGTGGGGGCTATGGCGGTGGTGGGGGCCATGGCG
GGGGCCATGGTGGTGGCCATGGCGGTGGCCATGGCGGTGGCCACTGCCCC
TACGGTTGCTGTGGACGTGGTTATTATGGAAGAGGCTGCAGGTGCTGCAC
TTACGCTGGTGAGGCTGTTGATACTGAGCCTGAAACCGAGCCTCAAAACT
GAAGCTCCATAATAAATTTGTATCTGTATCTCAATAAATAAATAATCTTG
CTTACATTTATGCGATGTAAGCTTCATTCTGTTTTTCCTTTTTTCTTTGT
TTTGTAAGTGCAATGTAAGCTGCTTGTTCACAAAAATAATACTTCTTTTA
TATTAAAGAAGTATTTATGAATAAATGAGTACATTTTTAGAGCTTTAAAA
GATCATTGGTGCTTCAATAAGTGCA
back to top