CN181485

Overview
NameCN181485
Unique NameCN181485
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length693
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Ruby Orange Developing Flower cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS04_0001A08_r Ruby Orange Developing Flower cDNA Library Citrus sinensis cDNA clone CS_REb0001A08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN181485 ID=CN181485|Name=CN181485|organism=Citrus sinensis|type=EST|length=693bp
GAGGAAGAAAAGAATTGCGTGAATTTCATATTCAACAGTCAATTGAAAAA
ACAAACAAAAAAATTACAGAGGCCAAGAAAAGGACTACGATAGAACAAAA
GACACCGAGAAAAAAAAAAAAACACAAGTGGACAACAATTTAAAGAGGCT
ATTGGCAGCACGATCAGAGACCAAATGCATAAGAAACTGCAATCAAAGAT
ATAATGGCATACGGCCACAAACCATGGGGCTGAGACAAACCAACTGCAGC
ACTGCATTCATCATTAGCGCCACTGAAACATCCCGGCTTTGATATTTTAG
CGACACCATCCTCAAAAACAAAGCTGGAATTGTGCTTGCCATTGCTGAAC
AGGACACACCAGAAATAGGGAGCCCCGCCGTCAGTGCCACTCACAGCAGC
CCCGACTTCAGTATGGTTCTTACTGTATAGAATATCTAAGCTCTTTTCAT
TTTTCATCAAGATATCTGAAAAAGCTTCAGAAGCATGAACATATCGGGAC
TGGCAGCCTAGCAAACGTCCAGTGATTTGAGTGAGGGACGAGGAAAGAAC
ACCGCAATTGGGAGCAAATGTGTCGGCAAACTCAGAAGCAGCAGGTCTTT
TGGCCTTTGGACCGCCCACATCATCGCAATGACCTTCATATGCTTTTATG
TACTGCAAAGCTATGCAGGCCAGGCCCGGGTTATCATGGAGCG
back to top