CN181484

Overview
NameCN181484
Unique NameCN181484
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length541
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Ruby Orange Developing Flower cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS04_0001A08_f Ruby Orange Developing Flower cDNA Library Citrus sinensis cDNA clone CS_REb0001A08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN181484 ID=CN181484|Name=CN181484|organism=Citrus sinensis|type=EST|length=541bp
ATTTTTATTAAATGATCCATGCTTATAATCAAAGAAACTATTAGTATTAC
AACATTTTACAGTACATGCACTCAACTCGTATTAAGAGATCCCTATATGT
TCATGGGCTTCAACTGTGCAGATGTAAAGATGAATAGGGAAACCTCTGGA
ATTACAAGAAACTGGTCTACTTCCAAGTTCCACCTTAAATTGATGAAATG
CTAGACCTTTGAGAAACTTTGCTCTTACATTGTGGGATTTCTTGAAACTG
CTCAGCAGGTAAATCCTCGGACAGAGCACCAACAAAGAACCTTAACACAT
CAGAATTTTTGACTGTCTCAATCCCAGTGACAGGCAACCAAAGGAACAAT
TTTTTAGCTTGAATGCCAGACACATCATGCACAGCACCATAACTAAGTTT
CCCTTTTATATGCTTGTCATACCAAACAAGCTGCTGAAAGTGAACATAGC
AAGTTCTTGTCATCTCAATAGAGAATGAGCCAGTGGATTTATCAAGAGTG
TACGACTTGATGTCGCTTGGAATCAGGCCCTTTGGGAGGCC
back to top