CN181481

Overview
NameCN181481
Unique NameCN181481
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length688
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2100 contig Csv1_Contig2100:324..1011. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ruby Orange Developing Flower cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS04_0001A06_f Ruby Orange Developing Flower cDNA Library Citrus sinensis cDNA clone CS_REb0001A06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN181481 ID=CN181481|Name=CN181481|organism=Citrus sinensis|type=EST|length=688bp
TTTTTTTTTTTTTTTTTAACACACAATTAAAACTAATTTTTATTATCAAC
ATATATATAAATGGAAGATGACAACATAACCAGATAACTCCGGTCTGTTT
ACAAAAGTCACCAGACTCACCCATACACACAAACACACAAGGGTATTATT
TAGGGCTGCAGATAGCTACCTCTGTGCTCAATGATAATTAACGAACAAAA
ACAAATAAAATACAGAAAATATTAACACATAATTATAATAAACTAAAAAA
GGTAGCGCACGCATCACATAATTAATTAAAAGAGATGGTGGTGCTTCTTT
CCATGAGCTTCCTCGTCTTCTTCCTTGGCTTCTTTCTTCTCATGGTGCTC
GTGGAACGCAAATCCTCCCGATCCAACGGCTGCTGCCGCGGCTATCTCCT
CCTCTATCTTGTGCCTGTGTGCATGCTCTGGGTCCTTTTCTGCCTTGTGC
TTCTCAAGCAGAGCAAAAGCACCAGCTGCACCAGTTCCAAGCTCTCCAAC
GTGCTCGAGATGCTTGTGGTGCTTCTCCTCCTTCTTGTAATCAAACTCTT
CCTCTTTCCTGCCATACTCACCGCTCTCCATCTCTGATGGCCGGCGCCGG
TCTCCCGGATAACCTGTAGTCTCAGAGTAATCGGTGGCTGACTGATCAGA
GTATCCGGTGGTCAAGTCGGAGTAACCGGTGGGGGTAT
back to top