CN188449

Overview
NameCN188449
Unique NameCN188449
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length441
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS05_0006A21_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0006A21, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188449 ID=CN188449; Name=CN188449; organism=Citrus sinensis; type=EST; length=441bp
GGTTCCAAAAAACAAGAAGCAGCATAAGAGCCATGAGTACGAGCCGAGTG
TTGGGACGGAAGGTGCAGTGGAGACCAAGGATCGCGGGATGCTTGATTTC
TTGGGGAAGAAAGAAGAGGAGAAACCTCAACATCACGATCAGGAGGTGAT
CGCCACCGAGTTTGAGAAAGTTCATGTCTCTGAGCCTCAGCCAAAGGTAG
AGGAACACAGGAAGGAGGAGAAAGAGGAAGAGAAGAAGCCCGGCTTCTTA
GACAAACTTCACCGATCCACCAGCAGCTCTAGCTCTTCAAGCGATGAGGA
GGAGGGCGATGATGAGGAAAAGAAGAAGAAGAAGAAGGAAAAGAAGGGAC
TGAAGGAGAAGCTCAAGGAGAAAATATCAGGTGAGAAAGAAGAGGACACG
ACAGTCCCTGTCGAGAAACTTGATGATGTCCATGCTCCCCA
back to top