CN188446

Overview
NameCN188446
Unique NameCN188446
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length795
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS05_0006A20_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0006A20, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188446 ID=CN188446; Name=CN188446; organism=Citrus sinensis; type=EST; length=795bp
TTTTTTTTTTTTTTATTAACCTTCTGTTTTGTTTTCTTCCAGGATTTACA
CCTTTAAGAAATTCAGAGTCAAAACTGACACTATGGACACTCCTACTGCA
AGCAAGTCAAATATGAATTACAAGTAACCAAGTTGCTGGGTTGATTGGTG
GCTTATCTTGTTTAACATTGAGATAAATTGATTGAATGTCTCCCCCAGCG
CATAAGCCGAACATATACCACCCTTGGCGCTCGCTGGCCTTTCAAAGTGA
CTCGGACATGGGCAGTCTGATAAGGTTATCAGCGTGATATACTGTAATAT
CACTCTGGAAAAGACACAATTTACTCCCGAAAAGCTACGATCCATCATAC
AAGAAAAAGGAACGTGTAACAGTATTGTCTATCCATTTTTTTTGCCCATA
TTCCAAGTCATTTTCAGCATTCAATTCCTTTGGATGAGCTAACAGCATCT
GCCATAACTTGTGGCCTCTATCAGAAACTAATTTGAACCCCTGTACAGCT
ATTTGTGGCTACTCTAACCAGTCCAGTTAATTTTCAGAATTTTAGAAAAA
AAAATAATTAAATAATTTTGGGAGATTACTCCAGGAACTGCAGTAGAAAA
GCATTCATCTATGTGCTACCTCAAAAAGCACCTCTGGTGCTCCTAAATTT
TGATGAGTCCTTTTGAAGTTGGTTGCCGAACATCCAACATAAGTACTTTT
AGTCCCAAACGGGCTCTAAGCTCCTTTCTTCTTATGATCTTTGGATTGCT
TAGTGTCCTCTTTTGTGAGCATTCTGGGTGCTATGGCCATGGCCA
back to top