CN188445

Overview
NameCN188445
Unique NameCN188445
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length421
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS05_0006A19_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0006A19, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188445 ID=CN188445; Name=CN188445; organism=Citrus sinensis; type=EST; length=421bp
TTGTCNTGGNCGTCTTGGTTCTCGAAGGGTCGGCTCAAGATCTCTCTCCC
GCTCCAGCTCCCGCTTCCGGAGCCGGCTCGATCTCGCCTTCCTTAGCCGC
CGCTGGTGTCGCTCTCCTTTCCGCTCTGGTGTTCGGCTCAGTTCTCAGGG
TTTAAGAGGCCGGATCTCTATCTGATTACGTGTCACTGGCTTATTGGGCG
TGAAGAGTGGTTTCTTCATATTTTTTTTTCTTTTTTTGCGTTGTTTAGAC
GTTATGTGGGCTTAGTAGCGGCGGATCCACTGGGTTCTTAGGCTTTTAGG
GAGTGAGTCTTATTACATATAAATTTTATAATGAGAGAGAGTTATCAGTT
ATGCTTTGAAGCTCACGGAGATGTGACGATATGATTTGATTTACGTTTGT
TATTTTTGGAGACTTATGATT
back to top