CN188438

Overview
NameCN188438
Unique NameCN188438
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length683
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS05_0006A16_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0006A16, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188438 ID=CN188438; Name=CN188438; organism=Citrus sinensis; type=EST; length=683bp
CAATCAATCTAACCTCCTTTTTATTACTCTCCAATACATCTACCCTTACA
TTTAAATGCAGCCATCACCCAAATATGAAAAAAACAAAAAACCAAAAGGT
GCCTCTACAATAGTTTACAACTCCCAGTACCCGAGAGGAAACAAAAAGAA
GATGGGAGGGGAAGAAAGAATAAATCCCAGTGTGCTATTTCCTGTGATTC
AACTATATTGGTATGGTTTGAAAAAGGCAGCACTTTTTAACCCTAAGGCC
ACTCAATGCTTTGTGAACATCCCTGCCGTTAGTGAAGAAAAATCATAATC
CTTTGCTGATTGGGAAGGAGTTGTTGATGAAACAGGGGATTCAGATGGTT
GTTTATTTGTTCCAGTGCTCGTCACACCATTTGCTGGATTAACTTGCCCC
ATAGTAGGAAAACTGGATGTAGGAAATGGAACAGAGTTCCCCCCTTGATG
TGTTGGTGCCATGCTCATAGCCTGCATAAGTTTCTGTATATCAGCCGGTC
CAGCAGCCACTTGATGTGTTGGTACCATGCTCATAGCCTGCATAAGTTTC
TGCAGATCAGCCGGGCCAGCACCCACTTGCTGTGCTGGTGCTATGCTCAT
AGCCTGCATGAGTTTTTGCAGATCAGCTGTTCCAGCACCTGGCATCATGA
TGCCAGGAATTTGGTTACCAAAGTTTGAGGGAA
back to top