CN188432

Overview
NameCN188432
Unique NameCN188432
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length523
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS05_0006A11_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0006A11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188432 ID=CN188432; Name=CN188432; organism=Citrus sinensis; type=EST; length=523bp
ATTTTCTCTTCTTCTTTTTCTTCTGGTTTCGAATTCTTACCTCTTCCCTT
TGTTTTATGGGTGTTTTCGCAAATTCTTGAAGTTGAAGGGAGAGGAGATG
ATGATGGCAAATTCAGAAACTGGAGGAAGAACTGAAGGCCAAGTACAAGT
TTTAATCAAGAATTTGTCTTGGGATCCATGGCCTAAACAATATTATTTGA
TGTTGCAACCATAACTATGAGGAAGGGTTAACCTCTAGGCAAGTCTAATG
CTTGGCTTTTTTTTTAAATTATCCTCCATTTTCTTTGTTTCCTATTTTTC
TCTTTCCTTTTGTTTCTTAGATTTAATTTTCTAGTTTGTTTGTGTGCCAA
CAAGAAAATGGAGGAGAATATGAATAACGTATAGGAAATCTTGAATTAAT
CTTTTATCACAAGATTTTCAGGGTTTCTCTTTCTTTAATTGTTGCCATAT
TACTGTCTTTTGTGGGCAGCAATAACCATGCATAATTAAACAAATTAATT
TTCTTTTAAAAAAAAAAAAAAAA
back to top