CK938599

Overview
NameCK938599
Unique NameCK938599
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length370
Libraries
Library NameType
Developing fruit albedo at 165 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004440_F08 Developing fruit albedo at 165 DAFB Citrus sinensis cDNA clone A1650001_IF_F08 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK938599 ID=CK938599|Name=CK938599|organism=Citrus sinensis|type=EST|length=370bp
GGGGAAAGTATCAAAATTTTAGAAGCAATCATATCTTTGAACAGTTCTGC
GTTCAATCTGATTCCCCAGGTGCACCTGCTTTAATCTTTTTTGAAGTTAT
TATTATTTCCAATTAATTGTTCTATTTCTGTAACTCATGTTTCTGATTTG
ATTTCGCTTAAAATGTTAAATAGCCAGTAGTATTCGTAATTTCATTTAAA
AAAAATCTATATTCTGTTAGTGAAAACTTTTCATTCTTCTTGGGTTGTTT
TGGATCTTTGCTTAGTCTACAACTAATCAATATACAGTGGGTTGTTGTCA
TTGTTTCTTGTTTTCCATTTTGCCTTAATTTGTTAAACTTCAAAAAAAAA
AAAAAAAAAAAAAAAAAAAA
back to top