CK938592

Overview
NameCK938592
Unique NameCK938592
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length815
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CK938592_ssr78 microsatellite CK938592_ssr78:78..89. BLAST: Citrus ESTs to Prunus persica proteins V1
CK938592_ssr257 microsatellite CK938592_ssr257:257..268. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig2120 contig Csv1_Contig2120:1..815. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Developing fruit albedo at 165 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004440_G08 Developing fruit albedo at 165 DAFB Citrus sinensis cDNA clone A1650001_IF_G08 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK938592 ID=CK938592|Name=CK938592|organism=Citrus sinensis|type=EST|length=815bp
GGGGAACATAAACGAATTTACTCTCTGATAAACACTTTTTAATATATATT
TTCACTTACCTGCAGTCGTAGCGCTATCTGCTGCTGCTGCTCAAAATGGC
TGAAAGGATCCACCCCGAAACGACACCGCGCAGCGAACAAGAGCCCTCAC
ATCCGCCGGCGCCCGCGGCCGCAGGAACCTACGTCATCCAAGTCCCGAAG
GATCAAATCTACCGAGTTCCGCCCCCCGAGAACGCCGACCGCATCAAGGG
CCTCTCCCGCCGCCGCCGCAAATCCCGCAGCACTACTACCTGCTGCTGCT
TCCGTTTCTGCTGCTGCTCGCTGCTTCTCCTCGTCCTCCTCTTGGCCATC
GCCGCCGGCGTCTTCTACCTCGGCTTCCGTCCCGAATCCCCCAACTACTC
CGTCGACGGCGTCTCCATCGCCGGCCTCAACCTCACCTCGCCGTCCTCCG
TCGTCTCTCCCCGGTTCGACGTCTCCGTCACCGCCGACAATCCGAACGAC
AAGATCGGAATCTACTACGAGAGAGGCAGCTCGGTGGAGGTCTCCTACAA
GGACGTCGCCTTGTGCGACGGCGAATGGCCTCAGTTTTACCAGCCGAGCA
ACAATGTCACGGTTTTCAAGACCTTGCTGAAAGGATCGTCCATCGAGTTG
ACCAGCTCTATGCGCAAAGACCTGGTTGCTGCTCAGACGAGTGGCAAGAC
GGTGCCGTTTAAGGTGAACTTAAGAGTGCCGGTTAAAACAAAAGTGGGGT
CGGTTAAGACGTGGACGATTAAGGTAAAAGTGAGATGNNNTCTAACGGTG
GATAAGCTGACGTCT
back to top