CK938589

Overview
NameCK938589
Unique NameCK938589
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length932
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CK938589_ssr115 microsatellite CK938589_ssr115:115..124. BLAST: Citrus ESTs to Prunus persica proteins V1
Libraries
Library NameType
Developing fruit albedo at 165 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004440_G05 Developing fruit albedo at 165 DAFB Citrus sinensis cDNA clone A1650001_IF_G05 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK938589 ID=CK938589|Name=CK938589|organism=Citrus sinensis|type=EST|length=932bp
GGGGAGTAAAAGCCCCATCAATCAAAGCATCCACATTAGATCTCCCCTGT
ATCTCTATTGCGTCTCAAAGCACAAACACAAACGGAGAGAAGAGAGATTG
TGTGCGTGCGTGTTTGTGTGTGTGTTAATGAGAGAGATGTCCAGGAGATC
AGGCAATTGTGTGAGGTGCTGTCTCGTAATATTTGCTGTAGTTTCAGCTC
TAGCTGTCTGTGGACCTGCTCTGTTTTGGAGATTTAAGAAGGGAGTTAGT
TTAGGTGATAACAAATCTTCTTGTCCTCATTGTAATTGCGATTGCCCTCC
TCCTCTTTCTCTTCTCAAGATTGCGCCTGGGTTAGCCAATCTCTCAGTCA
CAGATTGTGGAAGCAATGACCCTGACGTCAAGCAGGAGATGGAGAAGCAG
TTTGTCGATCTTCTGACAGAGGAATTGAAGCTGCAAGAAGCTGTTGCTGA
AGAGCACTTGCGCCATATGAACATAACCTTTGGTGAAGCAAAAAGGGTGG
CTTCCCAGTACCAAAAGGAGGCAGAAAGATGCAATGCTGCTACAGAAACC
TGTGAAGAGGCCAGAGAACGGGCTGAGGCCTTGCTGATCAAGGAGAGGAA
AGTAACTTCCTTGTGGGAGCGGCGAGCCCAGCAAATGGGATGGGAAGGAG
AATAGTTGACTGTATAATTTATCAACTTCTATACTCAGATTAGTGAATCG
TTCAAACACTTAATATCTATGCAAGCAGGCAGACAAGCAAGCAAAAAATT
TGCTTGAGTTGCTTGGTAAGGGGAGGGTTACTGTCTCTTGCTTCATATTC
TCTTGTTTTTTTTACTGCTATCTCCATTTGTAGTATTATTTCCAAAATTT
TATTCCTNCATTTCTTTGGTATTGACATTTTGTGGACTGCNNNNANTNNN
GTTTACAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top