EY659300

Overview
NameEY659300
Unique NameEY659300
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length591
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5338 contig Csv1_Contig5338:908..1497. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-008-F03-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659300 ID=EY659300|Name=EY659300|organism=Citrus sinensis|type=EST|length=591bp
TCCCCACACCAAACGAGGTGGTTATTTTTCCAGGTTCTCTTATTAACGTT
GAAGGAAGCAAGCTTGAGACGGGAGATATCTTCAAAACTGAATCTGATTC
AGCCACGGTGAACAGACCTCTAGATTCCAGTGCTTTGAAGCAAGCAGTCC
AAGGCCAGAAAGCAAATTACAGGGGTGAAAGTCCATCATCAAATTCTCAT
GGTCAGACATCATCATTTAATGGCCAAATAGCACTTCAAAATGGGGAAAA
GAAGGCAGCTGTTGGCAGAATGAAGAAGCTTAAAAGGAAGTATTTCTGCT
TCATGCCATTTTAAATGCTCTTCATTCCACACGAATAGTAATAGGATATA
GTTAAATTGCCCAATAGTAACTCAGTAAGCAGTCAAGTTCACACTGGCCA
AAGCTAGGTAATCATAGGTCGCAGTTTATAATTGATCAATATAATTGTGA
TGTTTATTGTGTTTGAAGGCCATTGATGTATGTAGATATATTTTATGAAA
GAAGACTTTGTACTCATCTGATTTCTATTTCTATGTGTGAAATTAGTTGA
AAGAAATGTTTTACATTCAAAAAAAAAAAAAAAAAAAAAAA
back to top