CK938372

Overview
NameCK938372
Unique NameCK938372
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length549
Alignments
Feature NameTypeLocationAnalysis
CK938372_ssr361 microsatellite CK938372_ssr361:361..372.
Libraries
Library NameType
Developing fruit albedo at 165 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004443_F10 Developing fruit albedo at 165 DAFB Citrus sinensis cDNA clone A1650001_IVF_F10 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK938372 ID=CK938372|Name=CK938372|organism=Citrus sinensis|type=EST|length=549bp
TTTTTTTTTTTTGCCTTTTTCGTTAATTAAATTTATTCTATGATTTTCTC
TTTTTGTAAAAAGCCCGTGGATTCTCTGCGTTGTCGTTTCACTTTTAAGC
AATTTTATAATTCGAAGAAGATCTAGCTAGGATTTCACTTCCCAGTTTTT
TATTTTCCTGGAAAGCTTGGATTTTTCCAGGAAAGTTCCGGCATTTCACC
TTCGCGAGGGAAAGAGCTCACTTTTCTCCGGCCGGCTGTATCTAGGGTTT
GCTTATCTGAATCTTTTCTCTTTGTGTAGTCAGTTTAGTGATATTGGAGA
TTTTAATATTTTTAATATATACATATTTTTTGTACTAGTTAGAGTTTGTT
GTGTGATCTATGTTTGTTTGTTGATTTCCATTTGTAGTGTTTGTTAGTTT
ATCTAAGGTTTAGTTTTGGAACCTTGAATTCTCAATTGGGTTTTCTTTGT
TGTGTTATCAAGGGCTTTTAAATCTTTATTGCTTAGATATTTGAAAAAAG
AAAAAAGAAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCTTG
back to top