CK938352

Overview
NameCK938352
Unique NameCK938352
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length344
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13600 contig Csv1_Contig13600:314..644. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Developing fruit albedo at 165 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004443_H05 Developing fruit albedo at 165 DAFB Citrus sinensis cDNA clone A1650001_IVF_H05 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK938352 ID=CK938352|Name=CK938352|organism=Citrus sinensis|type=EST|length=344bp
GGGGGGAAGGTTGCTCTTTCTGGACCAGATTCTGTTATTGGAAGGGGTCT
TGTACTCCACTCAAATCCCAGTCCAAATCCCGGTCCCGGAGTAGCTTGGG
GTGTCATCGGTCTCGATGCATGAAATGGCTTCTCTCCAAACCATAATAAA
TACATTTGACATGATGTTACATGTGTTATAAATATTTAATAAAATAAATA
ATATGTTGCACGAAGCATGGCTATAGTAAACTAAATAAAAGCCATAGCGT
AGCTGTAATATCTTGTACCAAGTAAAATGTAGTCAAGACGTACTATGCAT
TGCTCTTAATATAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top