CK937446

Overview
NameCK937446
Unique NameCK937446
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length417
Alignments
Feature NameTypeLocationAnalysis
CK937446_ssr301 microsatellite CK937446_ssr301:301..310.
CK937446_ssr352 microsatellite CK937446_ssr352:352..363.
Csv1_Contig13751 contig Csv1_Contig13751:1..417. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Developing fruit albedo at 80 DAFB in pTriplEx2 vectorcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004780_E03 Developing fruit albedo at 80 DAFB in pTriplEx2 vector Citrus sinensis cDNA clone A80DAB0003_IVF_E03 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK937446 ID=CK937446|Name=CK937446|organism=Citrus sinensis|type=EST|length=417bp
GGGGAGAGCATAAATGCGTTAGGGCAACTTAATTGCTTTTGTGTTTTGGT
TACGGTTACCATAAGCGAGTAGAGATCTTTTTTTATTACCTTGAAGAACA
TGGAAACTCCTTGCGCAGGTAATAACAATTGGTTTGAGGGGGTCCCTCAA
ATGTGGCAGGCCGGTATTGTTGATGGGGAGAATGTGAACGATAATCTCGA
TTTTCTTGTTGTTCCTCAATATGGAAGAAATCTTGATTACATTGGTTAAG
TGTATGAAATATTATTTTTATTTTTATGTGTAATAAAATAAGAATATGGA
TGTGTGTGTGTTAGTTTCAATATGTACTGTCTCTTTCTAAAACATAAAAA
GTAAATAAATAAAATTATTGTGTGTTAATTTGTTGACCAAAAAAAAAAAA
AAAAAAAAAAAAAAAAA
back to top