CK937437

Overview
NameCK937437
Unique NameCK937437
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length258
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5000 contig Csv1_Contig5000:301..558. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Developing fruit albedo at 80 DAFB in pTriplEx2 vectorcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004780_F10 Developing fruit albedo at 80 DAFB in pTriplEx2 vector Citrus sinensis cDNA clone A80DAB0003_IVF_F10 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK937437 ID=CK937437|Name=CK937437|organism=Citrus sinensis|type=EST|length=258bp
GGGTAATTATAAGAACTAGGTCTAAAATTATTGTGCAAGAAGGAAAAAGA
AAAATGTAATGGATTGTGGGTGCACTTAGATGGGATTCAGATATTTACTA
CTCTTTGTTCCAACTTCGAAACCTTTATTTACTTTTCTAGCTTCGGCTTA
TGTATGAGTAATGCAATGGTAAAAGTCTCCTAAGTTCAATTAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAGAATTTAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAA
back to top