CK937434

Overview
NameCK937434
Unique NameCK937434
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length184
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8794 contig Csv1_Contig8794:287..470. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Developing fruit albedo at 80 DAFB in pTriplEx2 vectorcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004780_H09 Developing fruit albedo at 80 DAFB in pTriplEx2 vector Citrus sinensis cDNA clone A80DAB0003_IVF_H09 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK937434 ID=CK937434|Name=CK937434|organism=Citrus sinensis|type=EST|length=184bp
GGGGAAGCATTAGATTATTATCATTATTACTATTTGTAATTTTTGTTGCT
TCGAGTATATTGGATTGATCCTTTGTTATATGGTTACGTCTTTCGTAATA
AAACGTTTGTGTTTCTTGCGCTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top