FC921776

Overview
NameFC921776
Unique NameFC921776
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length228
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13537 contig Csv1_Contig13537:2..229. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
RindPdigScdna_library
Properties
Property NameValue
Genbank descriptionC06052B12T7 RindPdigS Citrus sinensis cDNA clone C06052B12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC921776 ID=FC921776|Name=FC921776|organism=Citrus sinensis|type=EST|length=228bp
CAACAGACATAAATGGCGTGAGGCATTTGTAACCCATACTATAACCTTGT
GCTACAGAAAAATAAAGCTTAACAGCACTCCTGGTATGTTTCTGAAACTA
TTGTCATAGACAAAATACTGGCTGTCAGGTCATGAACAAGAGTAATAGAG
GCCATTTCCCTACGAGCTTAATTGCTTTGATCATATCTGACCTGACTCAT
CAAATCTGTTAACTGGCTAAAGTTAGAA
back to top