FC921763

Overview
NameFC921763
Unique NameFC921763
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length331
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13530 contig Csv1_Contig13530:1..332. BLAST: Citrus Unigene V1 Contigs to Populus V2 proteins
Libraries
Library NameType
RindPdigScdna_library
Properties
Property NameValue
Genbank descriptionC06052A11T7 RindPdigS Citrus sinensis cDNA clone C06052A11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC921763 ID=FC921763|Name=FC921763|organism=Citrus sinensis|type=EST|length=331bp
CGCGGGGGTGTCAAAGGCAAACCAAAACTTCATAGACTTTGAAGCTAACT
CTAATCAAAGAAGAAAAAAAGAGGTTATAATGGAAGGGCTAATTCCATAT
CTTGTCCATGCGATGAAGAAGCAAAAGCCACACCACAGCTACCGGAGCTT
CTCTGTGGGTTCGAGTCGTAGCTACCATTTGTTAATCGGAGGAGACTCGT
TTGAGGGCTCTTCCCACCGGCGAGCAAGGTCAGATTTTCAGCAGCCTGCT
GTGGAATTTCCAAGGCAACGATCCGGAGCTGAATTTATTAGTGGCGCTAT
CAAAGGTTCTGTAAATGCTCCTTCTCAGGCT
back to top