CK936490

Overview
NameCK936490
Unique NameCK936490
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length108
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1982 contig Csv1_Contig1982:2..109. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Developing fruit flavedo at 80 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004521_G04 Developing fruit flavedo at 80 DAFB Citrus sinensis cDNA clone F80DAB0001_IVF_G04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK936490 ID=CK936490|Name=CK936490|organism=Citrus sinensis|type=EST|length=108bp
GGGAAGTAAAATAACTTGTAAAGCTAGNNNNAGGAGCAAGTACCAATGGC
TTCCTCTATGATCTCCTCGGCCACCGTTGCCCCCGCGAACCGCGCCAGCC
TTGCTCAG
back to top