CK936484

Overview
NameCK936484
Unique NameCK936484
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length796
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9265 contig Csv1_Contig9265:18..813. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Developing fruit flavedo at 80 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004521_H06 Developing fruit flavedo at 80 DAFB Citrus sinensis cDNA clone F80DAB0001_IVF_H06 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK936484 ID=CK936484|Name=CK936484|organism=Citrus sinensis|type=EST|length=796bp
GGGGGAAAACAAACGAAACGAATCGGCAAAAACAATGAAGAAGAAACTCC
CTCTGTTCGCTCTGTTCTTATTCTTCTTCAGTCTTTTGTTGTTTTGTCAC
TCTTCTTTAGCTTTCGAATCCGACGAGCTTCTCGTCGATGACGAGGAATT
CGGCCTCGAAGGTGGATCGAAGCCCCAAATTAAGCCCCATGAACCCGCAC
CCACCCGATCCACGACCACAACGACTCGAAGGAAAGTTTCGGATCAGGAT
TCGGACTCTAAGATCCAATTCTCTTTAGAACACGCTTTTGGTGATTCCGA
TTTTGTCCCTGCTGGCACTTTCTCTGCTCGTCTCAAGACTTCGAGCCACG
GTGGCCAGACACTTACAAAGCTGCGTTTTTCAAGAAATGCTTTTACAGGA
GAGGACAAGGAGAAATTTGAAAAGCTACTGCAAGACGATGACTTCTACAG
GATAAGACTGCCATCCAATACTGTGAGCCCTCCTGGTAGGGATTACATTA
TTTCATCCGTGAAAGCAAGATGTCTTCCACGGGAGGGTTTGGACGAGCAT
TTTGTCATACACATGGAAGGAGTTAATATCTTGGCTGTCAATTATGGTGC
ATTTGGGGCATGTTCATATCCTAGGCAATTAAAACTTCCTCACAAGTGGT
CTTTCAACTCGCACACAGTTCTGAAGAACAGTGAGCAGGCACCAAGGGCA
CCAATTTTTGCTGAAGAGGTACTAGGCGAGAATGGAGAGGGTGAAATCAT
ACCCCCACCTGAAAGGTCCTTCTGGGCTAAATATTGGATGTACCTG
back to top