CK936482

Overview
NameCK936482
Unique NameCK936482
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length843
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1929 contig Csv1_Contig1929:1..843. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of CK936482 vs. ExPASy Swiss-Prot
Match: SUBL_ARATH (Subtilisin-like protease OS=Arabidopsis thaliana GN=ARA12 PE=1 SV=1)

HSP 1 Score: 124.02 bits (310), Expect = 1.032e-27
Identity = 75/175 (42.86%), Postives = 99/175 (56.57%), Query Frame = 1
Query:  130 SSAQKQKQVYIVHFGGSDNGEKA-LHEIQETHHSYLLSVKDNEEEARASHLYSYKHSINGFSAVLTPDEAARLSELEEVVSVYPSHPEKYSLQTTRSWEFVGLDEVAKQNSNHFNMGQDLLSKARYGQDVIVGLVDNGVWPESKSFSDEGMGPVPKSWKGICQTGVAFNSSLCNK 651
            SS+   +  YIVH   S       LH     + S L S+ D+ E      LY+Y+++I+GFS  LT +EA  L     V+SV P H  +Y L TTR+  F+GLDE             DL  +A    DV+VG++D GVWPESKS+SDEG GP+P SWKG C+ G  F +SLCN+
Sbjct:   23 SSSSSDQGTYIVHMAKSQMPSSFDLHS--NWYDSSLRSISDSAEL-----LYTYENAIHGFSTRLTQEEADSLMTQPGVISVLPEH--RYELHTTRTPLFLGLDEHTA----------DLFPEAGSYSDVVVGVLDTGVWPESKSYSDEGFGPIPSSWKGGCEAGTNFTASLCNR 178          
BLAST of CK936482 vs. ExPASy Swiss-Prot
Match: XSP1_ARATH (Xylem serine proteinase 1 OS=Arabidopsis thaliana GN=XSP1 PE=2 SV=1)

HSP 1 Score: 111.309 bits (277), Expect = 6.925e-24
Identity = 66/168 (39.29%), Postives = 98/168 (58.33%), Query Frame = 1
Query:  148 KQVYIVHFGGS-DNGEKALHEIQETHHSYLLSVKDNEEEARASHLYSYKHSINGFSAVLTPDEAARLSELEEVVSVYPSHPEKYSLQTTRSWEFVGLDEVAKQNSNHFNMGQDLLSKARYGQDVIVGLVDNGVWPESKSFSDEGMGPVPKSWKGICQTGVAFNSSLCN 648
            K  YI++ G   DN E+ +    +TH + L S+  ++EEA+   +YSY  + N F+A L+P EA ++ E+EEVVSV  S  +   L TT+SW+FVGL   AK++              +  +DVI+G++D G+ P+S+SF D G+GP P  WKG C  G   N + CN
Sbjct:   35 KDFYIIYLGDRPDNTEETI----KTHINLLSSLNISQEEAKERKVYSYTKAFNAFAAKLSPHEAKKMMEMEEVVSV--SRNQYRKLHTTKSWDFVGLPLTAKRH-------------LKAERDVIIGVLDTGITPDSESFLDHGLGPPPAKWKGSC--GPYKNFTGCN 181          
BLAST of CK936482 vs. ExPASy Swiss-Prot
Match: CUCM1_CUCME (Cucumisin OS=Cucumis melo PE=1 SV=1)

HSP 1 Score: 105.531 bits (262), Expect = 3.800e-22
Identity = 60/168 (35.71%), Postives = 87/168 (51.79%), Query Frame = 1
Query:  148 KQVYIVHFGGSDNGEKALHEIQETHHSYLLSVKDNEEEARASHLYSYKHSINGFSAVLTPDEAARLSELEEVVSVYPSHPEKYSLQTTRSWEFVGLDEVAKQNSNHFNMGQDLLSKARYGQDVIVGLVDNGVWPESKSFSDEGMGPVPKSWKGICQTGVAFNSSLCNK 651
            K +YIV+ G       + H     HH  +L        A  S L++YK S NGF+  LT +EA +++ +E VVSV+ +  E   L TTRSW+F+G      + S             +   +++VG++D G+WPES SF DEG  P P  WKG C+T    N+  CN+
Sbjct:   31 KNIYIVYMGRKLEDPDSAH----LHHRAMLEQVVGSTFAPESVLHTYKRSFNGFAVKLTEEEAEKIASMEGVVSVFLN--EMNELHTTRSWDFLGFPLTVPRRS-------------QVESNIVVGVLDTGIWPESPSFDDEGFSPPPPKWKGTCETS---NNFRCNR 176          
The following BLAST results are available for this feature:
BLAST of CK936482 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 3
Match NameE-valueIdentityDescription
SUBL_ARATH1.032e-2742.86Subtilisin-like protease OS=Arabidopsis thaliana G... [more]
XSP1_ARATH6.925e-2439.29Xylem serine proteinase 1 OS=Arabidopsis thaliana ... [more]
CUCM1_CUCME3.800e-2235.71Cucumisin OS=Cucumis melo PE=1 SV=1[more]
back to top
Libraries
Library NameType
Developing fruit flavedo at 80 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004521_H04 Developing fruit flavedo at 80 DAFB Citrus sinensis cDNA clone F80DAB0001_IVF_H04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK936482 ID=CK936482|Name=CK936482|organism=Citrus sinensis|type=EST|length=843bp
GGGGACTGCTACATACATACCTTTTAAGGTTACCTTAATTTAAACTACTC
CCATTATCTTCGCAACATTGCGTAAACAACCATGACCAAAATCTTCATCT
TCTTTCTTTTTCTCCTTACCCTTTTGGCCTCAAGTGCCCAAAAACAAAAA
CAGGTCTATATAGTGCACTTTGGTGGGAGCGATAATGGAGAGAAAGCTTT
GCATGAGATACAAGAAACCCATCATTCATATCTGCTATCTGTGAAAGACA
ATGAGGAAGAAGCCAGAGCTTCTCATCTTTACAGTTACAAGCATAGCATC
AATGGCTTTTCGGCAGTGCTCACGCCAGATGAAGCCGCCAGACTTTCTGA
ATTAGAAGAAGTGGTATCAGTTTATCCGAGCCACCCAGAGAAGTACTCAT
TGCAGACAACAAGGTCATGGGAATTTGTAGGCTTGGATGAAGTGGCAAAA
CAGAACTCGAATCACTTCAACATGGGGCAAGACTTGTTATCAAAAGCAAG
ATATGGCCAAGATGTAATTGTTGGACTCGTGGATAATGGTGTATGGCCAG
AATCAAAGAGCTTTAGTGATGAGGGAATGGGACCCGTTCCTAAATCATGG
AAGGGAATCTGCCAAACTGGAGTTGCTTTCAACTCTTCCCTTTGCAATAA
ATGGCCGTGGCCACCTCTCAGTTGGACGTTTTCGGAACTACCAAAGAGGC
CATTTTCAGTGACAGCGTTCACTTTTGGACTTTTATGTGATTGTATTGCA
AAAGTGATCCCATTGGTGGTTCGTTTCTTGTGTGTACGAATTAGACGACA
AAGAAGCAATTGACCTATATAATTATTGTTTTTTGGCCGAAAA
back to top