CN186187

Overview
NameCN186187
Unique NameCN186187
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length831
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
CN186187_ssr140 microsatellite CN186187_ssr140:140..151.
Csv1_Contig9189 contig Csv1_Contig9189:726..1556. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS05_0002I03_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0002I03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN186187 ID=CN186187|Name=CN186187|organism=Citrus sinensis|type=EST|length=831bp
TTTTTTCTAAGGACTAATAAAACACTTGTTTAATTTATTTATAGACTAAA
CTTTTGAGTCTCTACTCATATTACAACACACTTGGATCCTTCTATAGACA
CAGTAGAAGACCCCACAATATTACATTATAGTCAACTCTTTTATTTATTT
ATGGACTAGACTTAGAAGAGCTCTGCTCGTTACAACACACTTGAATCCTT
TTTATAAGCATACTAAAGGATCCTCCAACAAAACATCAATTACAATCATT
ACACAAACAATAATATTATCTAGAGGTAGTTAAATTACACAATACATTGA
CACAACTATATGTCCAATCTTATGTTTATATTAGATAATACCATTAATAC
ACATATCAACTTATCTCACCGTACAATATTCAATTCGAGTACAAGTTCCA
AAACACTTGACCATCAAAAGTATGATCAGAATCCACAACATCTCCTCCGT
GAAAAACCTCTAAAAGATTAATCTCCAAAACAAGAGAACCTCCGCGCAAC
ACTTCACGATCATATTTCAATTTGTTCAATGGAACTGTAGTTCTAACGCC
ATGAAAAGGACGATCCTTTTTATCATCACCTATAGGCTTATAACCATTAG
AAGAACCAGATGCAATAACACAAAGCGAGCTAGCGGGGTCCATATTATTG
ACACTTGGAGGAGGTAAATTTTTTCTCCAATTACTCTCCAGCTCGTGGGG
AACAACTATCACGGCCCAAGAAACAATGGGAGCCCAACTCCGACCAAACA
TACCAAAATCAATCCGGTCGTAGCTCTTCACTTCTTCAGTACCTGCATAA
AGCATAAAATAGTATTCTGATTTAGAACCTA
back to top