CN186186

Overview
NameCN186186
Unique NameCN186186
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length736
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CN186186_ssr330 microsatellite CN186186_ssr330:330..341. BLAST: Citrus ESTs to Prunus persica proteins V1
CN186186_ssr566 microsatellite CN186186_ssr566:566..577. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig2588 contig Csv1_Contig2588:9..744. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0002I02_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0002I02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN186186 ID=CN186186|Name=CN186186|organism=Citrus sinensis|type=EST|length=736bp
AGGCTCCCACATTCTCCAAATAATATAATCAGTATCTCATTTTCTGAGGC
TCGGATCGCAGCAGCACTCGCATCGCAGCTGTATATGGGGGAGAAGAAGG
TTACGACGATGGTGCTGAAGGTTGACCTTCAGTGCTCAAAGTGCTACAAG
AAAGTCAAGAAAGTACTTTGCAAATTCCCTCAAATACAAGACCAGATATT
CGATGAGAAGACGAATACGGTGAGAATAAAAGTAGTGTGCTGCAGTCCTG
AAAAGATCAGGGACAAACTATGCTGCAAAGGTGAAGGTTCAATCAAGAGT
ATTGCAATCCTGGAACCTGAAAAGCCTAAACCACCACCACCAAAACCCAA
AGAACCCGAGAAGCCAAAAGCACCTGAGAAACCCAAAGAACCCGAGAAGC
CAAAACAACCTGAAAAACCCAAAGAACCCGAGAAGCCAAAACAACCTGAG
AAACCCAAAGAGCCGGAGAAACCCAAAGAGCCCGAGAAACCTAAAGAGCC
CGAGAAACCTAAAGAGCCTGCGAAACCCAAAGAGCCAGAAAAGCCTAAAG
AGCCACCAAAACCATCACCACCACCACCGGCACCGGCACCGGCACCGGCA
CCTGCACCAGCACCGGCTCCAGTTCCGTGTCACCCGCCGGTCGGGGTGTG
CTGCAGGGAATGTTATGAGGGGCGCGGTGGGGGACCATGTTACGATCTTG
GCTATGGGCAAACGAGGCATTATGATGGGTACTGTG
back to top