CN186185

Overview
NameCN186185
Unique NameCN186185
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length585
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5880 contig Csv1_Contig5880:1296..1880. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0002I01_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0002I01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN186185 ID=CN186185|Name=CN186185|organism=Citrus sinensis|type=EST|length=585bp
TTTTTTTTTTTTTTTTTCTTTTTTTTTTTTACTTTCCACAATCACCTAGT
ACTACTAAAAAGTTTTGATCAATACTAGAAAATACAGATACCCCTCACCA
AGACAACGTAAGAAGCATGATAACAGGTATAATTAACACACAGCCATTGC
TACCGTTAAAACGGGTAGGGAATTACAAACCATTTAGAAAGCAAATGGGG
TTTAGTAGTCATTATCATATCAGGGGGTACCATCTTCAAAGGGGAGTCAT
GGCTATCGGTAGTAAGCCTGCTGAAAAGCTGGGGCCAAACCATTGCCATA
GCCCCCGTATGCAGGATAGTTCATGGGAGCACCCGGGTATGATCCAGCAA
GGGGAGGAGCTGCTTCTGGGGAGTAAGCATAGGGAGGACTCCTGCTGCCA
TACACCGCAGGGGGAGATGCATATGCTGTCACCCCAGCAGGGTATTGAGT
GTGTGAGGGAGACCTGACAAATGTAGGAGGGGCTGGGAAAGATGATACAT
ATGCATTGGGCAAACGGCCAGCCTTGGCTGGGGGCATTGGACCACCATTG
CTAGCACGTGTACGCTTGGGGGGAGGGACTGCAGC
back to top