CN186184

Overview
NameCN186184
Unique NameCN186184
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length782
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5880 contig Csv1_Contig5880:372..1153. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of CN186184 vs. ExPASy Swiss-Prot
Match: FRIGI_ARATH (Protein FRIGIDA OS=Arabidopsis thaliana GN=FRI PE=1 SV=1)

HSP 1 Score: 67.781 bits (164), Expect = 7.749e-11
Identity = 48/198 (24.24%), Postives = 89/198 (44.95%), Query Frame = 1
Query:   91 CLKMEARGFWKFVVTKKKEIEELRNALPAALSECVDPAKFVMEAISEVFPVDKRSDKSGNDLGWACVLVLESLIPVMVDPVIGKMRMLVTPSVKEKAKEIAERWKASLEERGGIENVKTPDVHTFLQLLVTFGIVKKEDVDLYRKLVVGSAWRKQMPKLAVSLGLGDKMPEMIEELISRGQQLDAVHFTYEVGLVDKF 684
            C  M ++G  K++     +  +L   +P+AL    +PAKFV++ I + +   +R+    + +  A  + L  L   ++ P  GK ++ +   +K++A+  A  W+  L   GG+   +  D    L L+  FG+           L+  S   +    L  S  L   +  ++E  I RG  ++A+   Y  G+ DKF
Sbjct:  149 CELMCSKGLRKYIYANISDQAKLMEEIPSALKLAKEPAKFVLDCIGKFYLQGRRAFTKESPMSSARQVSLLILESFLLMPDRGKGKVKIESWIKDEAETAAVAWRKRLMTEGGLAAAEKMDARGLLLLVACFGVPSNFRSTDLLDLIRMSGSNEIAGALKRSQFLVPMVSGIVESSIKRGMHIEALEMVYTFGMEDKF 346          
The following BLAST results are available for this feature:
BLAST of CN186184 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 1
Match NameE-valueIdentityDescription
FRIGI_ARATH7.749e-1124.24Protein FRIGIDA OS=Arabidopsis thaliana GN=FRI PE=... [more]
back to top
Properties
Property NameValue
Genbank descriptionUCRCS05_0002I01_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0002I01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN186184 ID=CN186184|Name=CN186184|organism=Citrus sinensis|type=EST|length=782bp
GCGACNCTGAATTCTATCTCGCGGGGGCAGGAGCTCCCCTTCAGCGAGGT
GGATGACGGAGACGGGTTGTTGATGATTCTGATGAGTTATTGTTTGAAAA
TGGAGGCGAGGGGGTTCTGGAAGTTTGTTGTAACAAAAAAGAAGGAAATT
GAGGAGTTGAGGAATGCGTTGCCGGCGGCGTTAAGTGAGTGCGTGGATCC
TGCTAAGTTTGTTATGGAGGCGATATCGGAGGTGTTTCCGGTGGATAAGA
GGAGTGACAAGAGCGGGAATGACTTGGGGTGGGCGTGTGTGTTGGTGTTG
GAGAGTTTGATACCGGTGATGGTGGACCCGGTGATTGGGAAAATGAGGAT
GTTGGTGACACCGAGTGTTAAGGAGAAGGCGAAGGAGATTGCGGAGAGGT
GGAAGGCGAGTCTGGAGGAGAGAGGAGGGATTGAGAATGTGAAGACGCCG
GATGTCCATACGTTCTTGCAGCTTTTGGTCACGTTTGGGATCGTTAAGAA
GGAGGATGTGGACTTGTATAGGAAGCTCGTGGTGGGTTCTGCGTGGCGGA
AGCAGATGCCTAAGCTAGCTGTTTCGCTTGGTTTGGGTGATAAGATGCCT
GAGATGATTGAAGAATTAATCAGTAGGGGACAACAGCTTGATGCGGTGCA
TTTTACATATGAAGTTGGCCTTGTGGACAAATTTCCCCCAGTTCCTCTGC
TTAAAGCTTTTCTGAAGGATGCTAAGAAAGCTGCTGTATCTATTCTTGAG
GACCCCAATAATGCTGGCCGAGCTGCGCACCT
back to top