CX046740

Overview
NameCX046740
Unique NameCX046740
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length410
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9585 contig Csv1_Contig9585:155..564. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS07_9H09_g Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-9H09-P17-1-6.g, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX046740 ID=CX046740|Name=CX046740|organism=Citrus sinensis|type=EST|length=410bp
TTTTTGTTGACACACACAATAACTTTTATTGATTTATTTCCTTTTTCAGG
AAAATACTTAGCTCAAAAGTAAACAAAAAGATTGCTTGTACGTCTCAAGA
AATCTTATAAGTTGAACTAAACCATACTAAAACATTGTCATGATTGATAG
GTAATAGTATACCTATCATTTATTTAATTAAACAAAACAGAAAAAAAAAA
AAGCAGTGCTGCACTTAACCCATGTAGTCGGGGTTTCTTCCATATTGGGG
GACATTAAGAAAATCAAGATTGTCGTTCATGACATCATCATCAGCAATAC
TGCCAAACGGAGGAAGCAGAAGACCCTCTGACCAGTTATTACCTGCGCAG
GTGGTTTCCATGTTCTTCAAATCAGAAAGATCTCTGCTTACGGGAATCAA
AGTTCGAAAG
back to top