CX046734

Overview
NameCX046734
Unique NameCX046734
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length614
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CX046734_ssr528 microsatellite CX046734_ssr528:528..549. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS07_9H06_g Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-9H06-P11-1-6.g, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX046734 ID=CX046734|Name=CX046734|organism=Citrus sinensis|type=EST|length=614bp
TCGGGCGGTTGATAGGCGACATGGTATTCGAATTTGAGAGAGGCGTGGAG
ATTCTGATTGAAAAAGAAAGAGTATTAGCTGATGTCGGTGGTGGGGTCCA
TTGTGTGGGGATTGGACGGTCGGAAATGCTCGGGCTAGCAAGTAATATTT
TCGGGAATTTTCATCAGCAGAATCTGTGGGTGGAATTTGATCTTGCCAGC
AGGAGGGTGGGTTTTGCTAAGGCTGAGTGTAGCAGATCAGTGTAGAGACG
TGGTGCTGGATTACCTTATGTTCACGGGCAGGGACATGTACATAAAAGAT
ATTTTCGTGAAATGTTGTACACAAAAACATCTGGCTTGACCATCTGATCA
TCTGGTGATGATCTGGTCTATGGGCTACGTCGAGCTAGGGCCAGGATTAA
GTGAGATCGGGGCATTTAAGAAGTGGGGCATATGGAGTCCCACTGTTGGC
ATGATGTATTGATGTTCGATGTAAGCCCACGGTGGTTGTATAATTTGAGA
CTAGTACTCAATGTACATACGAGGATAATATATATATATATATATATATG
CAACTATTTTCCTAACCTCCTTTTGCCTTCTAAATATTAAACAGCTATAA
AAAAAAAAAAAAAA
back to top