CV998082

Overview
NameCV998082
Unique NameCV998082
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length365
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3799 contig Csv1_Contig3799:1160..1523. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS07_D-1_T7 Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07-153 Citrus sinensis cDNA clone TC43_C06_044, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CV998082 ID=CV998082|Name=CV998082|organism=Citrus sinensis|type=EST|length=365bp
ATAAATAGCTAGACAAAGAGAATCTCTTGTATATATCAAGAGATCTTACA
AGTTAAACTGAACCAAACTGAGACCATCGTACAATTGACGGGTAATAACA
GTACCCATACTTTTATTTTCTTAAACATAACATAAGAGACTAATACTGCA
TATTCTTAACCAGTGTGATCAGGGTTTCTTCCATATTGTGGGACTACAAG
AAGATCAATATTTCCATTAATTTCATCATCAGCAATAAGTGAAAACCATG
GGGGGGCCCCACCCTCCGACCAATCGGTATAACCTGCGCAAGGAGTTCCC
ATAATCTTCAAATCAGGAAGGCAAAAGATTTCTGCTGGCTTCGACTGAAC
CGTATTCAAAACCCT
back to top