CV998072

Overview
NameCV998072
Unique NameCV998072
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length897
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3560 contig Csv1_Contig3560:1..897. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS07_CTMN-2_T7 Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07-153 Citrus sinensis cDNA clone TC32_H04_018, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CV998072 ID=CV998072|Name=CV998072|organism=Citrus sinensis|type=EST|length=897bp
TTTTTTTTTTTTTTTTTGGTCAGAATATCAACTACGGTATCATTAGCAGC
CAAACAAGATAAAACAATGATGTGCAACTTTTACATCTGAAGGGTATCAG
TCAAAAGATTTCTAGAGTTCGAAGTATTTCACATTTGAATTAACAGATGC
CAAATAAACAGTTTCAATTCTTTTTTTTTTTTTAACAGGTTATCATCTAT
TCTGTAACACAAATGTGGGAAAAATAATTATATTAACCAAGCCACTGTTG
TGCACGACGTTCACCCCCACTTCCAACAGCACGACGGATGCTAATTTTCT
CATTAGCATATTTTTGCTGAAGTAATTCAAAAGCATTCACATCAAGTTTC
CCAGTTACTGACTTCCCTTGCCTCCTACGATTTTGCTGTTCGCGTATAGA
AGCCCAAAGTTTTGCAATGGCATCCCTTTGTTGAGAAGTGAATCTTGCTA
CATTATCGAAAGCATGCTTCACCAAGATGTCTATCACTGTTTGGCACCAT
GGGGTTTTGTAACGATGTGCTGCAATCTCTAAACCAGTAATTAAGGCTTC
CCTCTGCGACTTGAGAAATCTCTTATACTCTTCCTCGTCCTCTTTTATCT
TCGCTCCTGTCTCTTTCTTTCCCTTTGTCCTATCATCTTTCCTTATTCTT
TTTGGAATGAATGCATCGAGCCCAAATGGATCAGCCTCATCTTTGTGATT
TTCTTCAGCCTGCACAGCTGGAGGCATGTCCCGTTTGTTTTTACTGTCTT
CATTAGTTTTTTCTGCCTCATCTTTCAAGGCCGCAGCCTCCTCCAGATCA
TCATCCTTGGTAGCAACTGGAAGACTAGATATTGCCTCTTTTATTCTTGT
CGCTGTTTTTGAAAACACAAAGCTGTCATCGGTGAACAAGTCATCCT
back to top