CX046728

Overview
NameCX046728
Unique NameCX046728
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length360
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1719 contig Csv1_Contig1719:48..407. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS07_9H03_g Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-9H03-P5-1-6.g, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX046728 ID=CX046728|Name=CX046728|organism=Citrus sinensis|type=EST|length=360bp
GTTCAGTCGAAGCCAGCAGAAATCTTTTGCCTTCCTGATTTGAAGATTAT
GGGAACTCCTTGCGCAGGTTATACCGATTGGTCGGAGGGTGGGGCCCCCC
CATGGTTTTCACTTATTGCTGATGATGAAATTAATGGAAATATTGATCTT
CTTGTAGTCCCACAATATGGAAGAAACCCTGATCACACTGGTTAAGAATA
TGCAGTATTAGTCTCTTATGTTATGTTTAAGAAAATAAAAGTATGGGTAC
TGTTATTACCCGTCAATTGTACGATGGTCTCAGTTTGGTTCAGTTTAACT
TGTAAGATCTCTTGATATATACAAGAGATTCTCTTTGTCTAGCTAAAAAA
AAAAAAAAAA
back to top