CX046726

Overview
NameCX046726
Unique NameCX046726
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length486
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2383 contig Csv1_Contig2383:322..807. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS07_9H02_g Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-9H02-P3-1-6.g, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX046726 ID=CX046726|Name=CX046726|organism=Citrus sinensis|type=EST|length=486bp
TTGAGTTTATTTCAAAAAAAAGTACAACATTTAGGAAGAGAGATCGTAAT
TAAAACCGACGTGTATAAACTAATAGAACCAATATGTTGACACACACAAT
AACTTTTATTGATTTATTTCCTTTTTCAGGAAAATACTTAGCTCAAAAGT
AAACAAAAAGATTGCTTGTACGTCTCAAGAAATCTTATAAGTTGAACTAA
ACCATACTAAAACATTGTCATGATTGATAGGTAATAGTATACCTATCATT
TATTTAATTAAACAAAACAGAAAAAAAAAAAAGCAGTGCTGCACTTAACC
CATGTAGTCGGGGTTTCTTCCATATTGGGGGACATTAAGAAAATCAAGAT
TGTCGTTCATGACATCATCATCAGCAATACTGCCAAACGGAGGAAGCAGA
AGACCCTCTGACCAGTTATTACCTGCGCAGGTGGTTTCCATGTTCTTCAA
ATCAGAAAGATCTCTGCTTACGGGAATCAAAGTTCG
back to top