EH668996

Overview
NameEH668996
Unique NameEH668996
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length623
Libraries
Library NameType
Citrus zygotic embryos (subtractive cDNA library)cdna_library
Properties
Property NameValue
Genbank descriptionzigotyc6 Citrus zygotic embryos (subtractive cDNA library) Citrus sinensis cDNA clone zigotyc6 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH668996 ID=EH668996|Name=EH668996|organism=Citrus sinensis|type=EST|length=623bp
TCGCGCCGACGATCACGCCGAGTGGTATCCAGACTTTCCGACGCTCGTCC
GCTGAAGAGGCGCGTCTCTTAGATAAATACCGGAAAGGAGACCTCCGGTA
TGGACATCTACCAGCACTTTCATCGCCACGGTCTATGCGGCTCAAAACGT
GAGTTCAGCAGCGCGATTCTCAGCAGGGCCGAAAATTACATGTGCCTTCG
CGGCGAGCGTGGCCCCTCAGCCGACGCCCTGATTGAACTCTTCCAGACCC
TCTGGCGCGAAGGTCGCCTGATGCTCGCGGCACGGGTTGCGTGGGCGGTG
CTGTGGCTGAAGCCGGAGGCGCGGCGATGAACGACGACTATGACGACCTG
CTGTTCGGCTTCGATGACATCGAACGCTACAAGCGAGGAGAACAGCCGGA
GGGGTGGTTTGGCGAACGGATTGACATCCTTTTGGCGCGCTGTCGCGCTC
AACAGACCCGCCTTGGAAAGTTGGTCGCCTCGGCTCCCCCCGCTGTTGTG
GCTGGGTTCAACAAGCCCCTCTAAGTTTCTCCGCACGTTAGGTGCTTAGC
CGTCGAAGTGGTCGGCTTCTGCCTCACACTCCCAGCCTTTGATGTGCTCA
CCCACCTCGGCCGCGACCACGCT
back to top