EY665452

Overview
NameEY665452
Unique NameEY665452
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length386
Alignments
Feature NameTypeLocationAnalysis
EY665452_ssr200 microsatellite EY665452_ssr200:200..217.
Properties
Property NameValue
Genbank descriptionCS00-C1-102-002-C04-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 2 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY665452 ID=EY665452|Name=EY665452|organism=Citrus sinensis|type=EST|length=386bp
CACCCGGAAACCTCAGGACGGGCCCGGATTCCCGGGTCGACCCCGCGTCC
GCGTATTTTATTCAATCTGCCCCTTATGCATATACATAAAATGGAAGGGA
TTGCAGAAGAAACCTTTTTCTATTGGTTCAAAATAGGCTTCCATTGGCTG
CCTACTCATCATTTGAATTGAGTAATGTATTCCATTGCATTGATTTTCCT
GTGTGTGTGTGTGTGTGTTAATGAGTATGTTTCAGTCACGCTCACAGATG
TACATTTATTTAAATTGAAGTTTTTGCTTAGTGTGTTATGTATCATTGCT
ATATATTGATGATATCGTAATGTAATTTGCCCACGGAGNGATATTCTGTT
GCAAAAAAAAAAAACAAAAAAAAAAAAACAAAAAAA
back to top