EY665437

Overview
NameEY665437
Unique NameEY665437
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length897
Properties
Property NameValue
Genbank descriptionCS00-C1-102-002-A02-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 2 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY665437 ID=EY665437|Name=EY665437|organism=Citrus sinensis|type=EST|length=897bp
CGGGCGGGTACCGGGCCCGGAATTCCCAGGTCGACCCACCGCGTCCGTAA
AGAGGTAATATCCAAACCCTTTTCTTTTTTGTCCCTTTCATTAAACCAAA
ACCCTAGCCCTTCTCTAACGCCGAATGCACTGAAGAAGCTGCTGAAACCA
TTCAAACGATCCTGCAGCTGTTTAATCAGAGCTATGAACGAGAGAAGCTT
TGGCGGTGGCACAAGGGTCCGGCGAACTAGTTTCGCCGGCGGTCGGTCGT
CGAAGACGACTGGCATTGGATCGCGTAGAAGGTTAGTCTTCAAGAAGCTC
CGCTGCTTGTTAGAGTGGGTGATTTTTATTTTTTAGATTATTAAGATTGA
AAAATCTAAAATTGATTCCTTGAAGAAGCTGTTGGTGTTGCGATGTTTTA
TGAAAATGAAAAGGTTTGTTGATATGTTAAAAAGAAGCTGTTGTATGTTG
ATATTGTCACTTTCACTATCTGATTTGGACATGGCTATGAGCTAAAACAA
CCATCCGAAAGTTATAAGGAAATGATCTTTACGTTAATTTTGGGTTTTGA
AAAAATGGGGTTTATTTCAATCAATTCAAAAAAACGGGGGCCTGTTGGTT
AAAATGGAACTTGCCTAATATGTGCCTTGCCGTAATTAAAACTAAGGCCT
TAAAAAAAAACTATGAACTTTGTAATGGCTTGTAAAGGTAGGAAAAGGCC
GGTTCTAAATTTGGGACCGGCTTCAAACTACCCGAAAAAGGATAGTTGTT
TTTGCCTTTTCCTTATATGGGAAGCTATTTAAGGGATTTTTTCCCTCGAT
TAATTGAACCACAAAATGAGGTATAACTCCAGGGGGGACATTAGGGGGGG
GAAAAAGTAAAACAAGCGGGGGGCAGGAAAAATCCCTGTCCTTTTCC
back to top