EY665422

Overview
NameEY665422
Unique NameEY665422
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1121
Properties
Property NameValue
Genbank descriptionCS00-C1-101-007-G04-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY665422 ID=EY665422|Name=EY665422|organism=Citrus sinensis|type=EST|length=1121bp
ATCTTCCGCCGTTCTCCTGATAGATCCAGATCAAGGTCTGCTTCTCGCTC
ACGCTCTGGATCAAAGCCTCGCTCTTTGTCAAGGTATGCTTCGTTATTAT
CCTTTGTTATGCATGTTGGGATTGTACGTGAAACTTAATACTTTCTTATG
GTAATCTTGATTTGACAGATAGAAGCTTTACTTTAAAATTGCTTTAAGTT
CTGCATAGTTTATTTCATTTGATTTCAAATTATTGGTTCTTCTTGAAGCC
GCTCAAGTATTTTTAATATACCTTCTCCTTTGAAACATGTAATGCTCATG
TAAAGGGAGACATGTGCATGCAAACATTGGTTGGAGTAATTCTATCAAAT
TAATTTACCTTGGGGTAAATTATATCAGATCTTAGCTGGGTTGATTTGGA
AAGGATTGTGGCGAAAACATTTCTTGCGCACTTTGCAATTTTCTGTGACA
TTTTCCTGAAGATATGAAAAGTAAATAAATTTTCCCAGTGTGGTGTATAG
AATTTTTATTTTTGAACTTCAAGGCCTAATTCCCCATGGGGATGGGGGTT
TACTGAAAAAAAAAAACCCTGGGGGTCAAAAACGGGCTTCATTTTCCTCT
TTTAAGGGTATGAACATTTTGCCCTTTTTTGTGGTTTTTTAAAAAAAAGG
GGAAAATTGGGGCTGGCAAAACGGGGGAATTTGGGAATTTTAAGAAATTT
TGGAAGGGGAAAAATTGTGTTCAATTTTGGTTTTGGCAACCTTTTTAGGG
GGGGGGAAAAAGGGTTGGCCTCTTTTTCCAAAAAGGGGGCAAAATTTGGG
GAAAACCCTTTTAGGGGGAATTTCTCTTTTTTTCTAAAAAGGCATTTTTT
TAACCACCCCCACAGAGGGGTCCCCGGGTGGGGTTTGTTAAATATATGGG
GAAAAAAAAAAGGGGAAAAAAAAAAAAAAGGGGGGTGTTGGAGAAAAAAA
TAAAAAAAAAAAAAAGCGCGGTGGGGGTTTTTTTTTTCTTCCTGCGGGTG
AAATAATATTTTATAATGGGGGGGGGCGCCCCCCTTTTTTTGTTTTGTTT
GGTGGATATAATTCTGATCTCTGTGGGTGTGGGGAAGGAAAGGAAGAGAA
AAAAAATGATGATTCTCTTTC
back to top