EY665418

Overview
NameEY665418
Unique NameEY665418
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1098
Alignments
Feature NameTypeLocationAnalysis
EY665418_ssr107 microsatellite EY665418_ssr107:107..118.
Properties
Property NameValue
Genbank descriptionCS00-C1-101-007-F12-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY665418 ID=EY665418|Name=EY665418|organism=Citrus sinensis|type=EST|length=1098bp
CTTACGGAAACTCATACCACCAGGAGCCACTCCTACCCATCCCAGCCAAT
CAAATACAACTTCAAATACCAGGTCCATGACCCCCACACCCACGACGTCA
AGAGCCAAGAAGAAGAAGGTGACGGACACTACGTCAAGGGAGTCTACAGG
CTTCACGAACCCTACGGAGGAGAACGTACCGTCCAATACTCCGACAACGG
ACACGGATTCGTCGCTCACGTCCAGACCGCTCACATCTCTCACCCACAAA
ACTACCAACGTTACCAACACCAGTCATCTTACGGAAGCCAACCATCATAC
GGAAGCCAACAATCCTACGGAAGCCAACAATCCTACGGAAGCCAATCCTA
CGGATCCCAACCATCTTACTAAGATGTCCAAAAGGGTCGAATAGTTAACA
ATTTAATCCCCATACCGTAAATTTGCGTCCCAAACCTTCAAATTTCTTAG
AAGGAATTAAATAGCGTGGGAAGGTCATTGTAAAAAAATTACGAGTAGAT
CCGTTGCTTTTAATTAATTGATATTTATTTTGGATGGTGGGGAAAGAAGC
AAAAAAAGGGATAATTTACCGGGCCACGAAAAAAAGAGACGAATATGAAA
AATGAATAATTTCTGAGGAAGTAAAATAGAAAGAGCGAAAGTAGAAGATA
TAAAAATCAAGATGAAAGGACCGAAAAAAAACAAGGAGAGGACACAGAAA
CGTAAGAATGAACTCACAAGAACAGAAAATGAACAAATAAAGTAGATAAG
TTAGAAAGAAGGGAAAAATGCGGGAGGGGAAAAAATAACCAGAGGAGCGA
GGAAAGGGAGGGAAGGAGACCGAAGCCGCGACGCAGCGACGAGACGAACA
CAGGCACGAACAGGAACAAAAATCAAGGAATGAGAGCCGTAGGCGTCCCT
ACTAGAAGAAGAAGGCAACAAGAAGAAAAAGAAACGTCAACGAGTTCCTA
AAAGCAGACCGAAGCCCGACGCGATAATACGGGGAAAAACGTAGAGAGAC
TCTGTCAAACGTACGGAATTGCGAGAAAGACAGGCAAGCGACGAAAGAGG
GGAATAACGTGAGCCGCACGACACACGAAAAACGATGCTGACGGAACC
back to top