EY665414

Overview
NameEY665414
Unique NameEY665414
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length951
Properties
Property NameValue
Genbank descriptionCS00-C1-101-007-F08-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY665414 ID=EY665414|Name=EY665414|organism=Citrus sinensis|type=EST|length=951bp
GAAAGGACCTTTGTGCGACACAATAAAATCTTTGGGGTCATATCATAATT
TTAAAAAGTTTGGGAAAGACACTATTCTTGAGAAGTTCTGAAATTGGACC
TATTTGCAAATTTTTCTGACGTTTTGGGCCATATTATAATTATAGAAAGT
TTTGGGCCAAAGTGTAATTTCAATGAACAGTGTTACTGTAGCAAATTCAA
AAATAACGGTAATATTACTGTTCCTGAGCGGCTAGCCGGATAAATCAAGC
GGCTAACCGCTTGAGCGCTGGAATTTGCCTATAACGGCTAGTTTTTGGGC
TTCCACAATAAAAACTCAACTCAAACTTCATTTTAAGAACTAACACAAGC
AAATATAAGATCATATAACATATATTGAGCTTCCATTTCGTANATCATCA
TTTGTTTGAATCATCATTGAGCTATAATTTGTTATTCACTCTTAAAGAGA
GTTTTATTGTTGTGAATTTCATTTCTCATCAATTTGTGAGTGTACAAGTG
TGGGAAACACTTGGGGTGAAAAAATGGGGGATATAATCTCTTGTTGTAAA
GGGTCATTGACCCCTTGGAAATCAATTGTAAACTTTTGAAGCCTTGGGAG
GTTGGGAAAGGGAAATCCTAAAGCCGGGGGAGCTTGGAGGCGGGGAATTA
AGGGGGGAAAACCCAAACCCCCTTANAGAAAAAAATAGACTAAAGCAGAC
TATAAATGAGCTCGACATGGAAAAAATAAACAATAATAAAAAAACTAAAG
GGGGGGGGCCCCCCCCAAAGAGAACCCAGCCTATAAACACCCGGGGGCGG
GGGCACCCCCAAACCCTCTCTTTTAAGGGGGGCCCCCAAAAATTTCATTT
TTCCCGGGGGGCGGGGCTTTTTTTAAAAAAACCCGCGGGGGGGGGGGGGG
AAAAAAAACCCCCGGGGGGGTTGACTTCCCCCCCCAAAAATTTTTATAAA
C
back to top