EY665410

Overview
NameEY665410
Unique NameEY665410
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length669
Alignments
Feature NameTypeLocationAnalysis
EY665410_ssr203 microsatellite EY665410_ssr203:203..218.
Csv1_Contig8008 contig Csv1_Contig8008:1..669. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS00-C1-101-007-F04-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY665410 ID=EY665410|Name=EY665410|organism=Citrus sinensis|type=EST|length=669bp
ATTCGAACTGCGTACGGTCGGAATTCCGGGTCGACCACGCGTCCGGGTGT
TCACGGTGCGAACTGCACTGTACCAAATTATTTTACTGCAGAAAACTTGA
CAGAGGTGCACACATATGCTTTAGAATGCTAGAGATTGGCGCTTCTACTT
CACAGGAAGTTGTTCAACTAAGCTTGCATGGATTTTTTGGCATGCTTGAT
GTTGGATGGATGGATGGACGGATGTAATTTGTTGCTGGAATTCTGTGTCT
TGTTTTCTTTCTTCCACCAGTAAAAGTTTTAGGACCATGCTCTTAAAGTC
TGATATGATGTGCCGAAATGTACAAATTATCTCAGTAGTTACACAAAAGT
TTTATGGATCTTGTTCTTTTCCGCTTAACAAAATTTGTTGTTCGATGGTA
ATAAATCCTTGTCTCGTCTACAAGAAGGCTCTTGATAGAATGTGACACTT
TGCTGAGATTCGATGTTGTTAACGTACGTTGCTCTAATTGTTACCCGAAC
AAGATGACAAATCTGCTAATATTTTAATATGAACAAGAAATCCCGTCAGA
AATAATAAATCCAATTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGG
GCGCTCCAAAAGGATCAAACTTTACGTACCCTGGCTGGCAAAGCCATACC
TCTTTCAATGGGGCCCCCA
back to top