CX043346

Overview
NameCX043346
Unique NameCX043346
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length572
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS07_10E03_g Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-10E03-J6-1-6.g, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX043346 ID=CX043346; Name=CX043346; organism=Citrus sinensis; type=EST; length=572bp
GGGTGCTGGAGCAGGCGGGGCACTAGGTGGTGCTGCTGGAGGATTGGGTG
GAGGGTCCTCTTTGTACAGGTTGCCACCGAGTTCGGCTGGAATGCCATCT
GGAGGGTATCCTGAGGCCGGGCATTACGGCTTGTCATCTACTTCGGCCGG
TTATCCAAGTCAGCATCACCAGGCAGCAGGGACGTCTCCAGTTCCTAGAG
TTCCTCCGGGTGGAATGTACCCGAACGTGCCGCCTTACTATTGAGGTGTA
TGACAGCTTGTTGGCGCAGATGCTTTTTGTGGTTCTGGTGATTTCGTAAT
GCAGACTATATGATTGTATTAGCTTTGCTTTTACGGCCACTTCTTCGCTT
GATGTCTTGATCTGCACCTTTAAGATGTGGTTTATTTCTGAATGATGGTT
TTCCAAATGACTGAGTTAGCCTAGTTTGTACTTATGACAGAACATATTTG
CCATTTGGGCTTTTCAAGTACTAGTATAGCTCTTACAAGTATTCAGATCA
TATTTCCTTGTTTGGAGCGACTGTGTACGGTTGTTGCTGTAATTTATATT
TTGTTAGGTTTTCTTTAAAAAA
back to top