CX043345

Overview
NameCX043345
Unique NameCX043345
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length576
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS07_10E03_b Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-10E03-J6-1-7.b, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX043345 ID=CX043345; Name=CX043345; organism=Citrus sinensis; type=EST; length=576bp
TTTTTTTAAAGAAAACCTAACAAAATATAAATTACAGCAACAACCGTACA
CAGTCGCTCCAAACAAGGAAATATGATCTGAATACTTGTAAGAGCTATAC
TAGTACTTGAAAAGCCCAAATGGCAAATATGTTCTGTCATAAGTACAAAC
TAGGCTAACTCAGTCATTTGGAAAACCATCATTCAGAAATAAACCACATC
TTAAAGGTGCAGATCAAGACATCAAGCGAAGAAGTGGCCGTAAAAGCAAA
GCTAATACAATCATATAGTCTGCATTACGAAATCACCAGAACCACAAAAA
GCATCTGCGCCAACAAGCTGTCATACACCTCAATAGTAAGGCGGCACGTT
CGGGTACATTCCACCCGGAGGAACTCTAGGAACTGGAGACGTCCCTGCTG
CCTGGTGATGCTGACTTGGATAACCGGCCGAAGTAGATGACAAGCCGTAA
TGCCCGGCCTCAGGATACCCTCCAGATGGCATTCCAGCCGAACTCGGTGG
CAACCTGTACAAAGAGGACCCTCCACCCAATCCTCCAGCAGCACCACCTA
GTGCCCCGCCTGCTCCAGCACCCCCT
back to top