CX043344

Overview
NameCX043344
Unique NameCX043344
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length795
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS07_10E02_g Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-10E02-J4-1-6.g, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX043344 ID=CX043344; Name=CX043344; organism=Citrus sinensis; type=EST; length=795bp
CTTTTAAGGCCTCTTTATAAATCATATCACCTCTTTATTGCCTTCCGTTT
CTGGAGCAGAGAAATGACTTCAGAAATTTTGATTACTAAAGACTTTCTTG
GAGGATTGTCAAATAACACAGAATCTGATCTCAACTCAAAGACAGAACAC
GCAAGCCATGAGAGATGCAGCTCACCCAACTCGCCATTATCTTCATCATT
ATCGTCGGATCATCAGACACAAACAAACCCAGCTGCTGATTTTGAAGCCC
TTAACTTAAACTACCCGCCGCCGTCATCGTCCTCATCATCAGCAGCAGCA
CAAATGAATCTTTTCGAAGAAGCGTGCTTAGACCTAAAGCTTCAGTCTTC
ATCATCGTCTTCAAGCCATAATTACCAAAGTGTTTGTACGCTAGACAAGG
TCAAGTCAGCCCTACAAAGAGCAGAGAAAGAGACGGAGAAGAAACGGCAG
TCGCTTTCGTCGTCGTCAGCTATGTTTGCCGCTGCCTGCCCTGGTTGCTT
GCTTTACGTGATCACCCTAAAGACAAACCCTAAGTGCCCGCGTTGCAATT
CTACTGTTCCTTCTCCTTTAGTTGTTAAGAAGGCCAGAATTGATCTCAAT
GCTTCGTTTTAATAAATTTTAAAGCAAACTCCTTTTTCTTCATTCTTCCA
TGTAACTTCTTCTTCTTCTTTTTTCATTTCTTTTTCATTTTGTACAGTGA
AATCATATCATAGGTTTTTGTTTTTCTGTACTTTGTTATTANGGTTGGGG
GATCATGGTATAAAATATTTTATAGAAAAAAATGATTGTAATTAA
back to top