CV884655

Overview
NameCV884655
Unique NameCV884655
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length907
Libraries
Library NameType
Ruby Orange Developing Flower cDNA Library UCRCS04-UCRcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11206 contig Csv1_Contig11206:42..948. BLAST: Citrus Unigene V1 Contigs to Populus V2 proteins
Properties
Property NameValue
Genbank descriptionUCRCS04_2_008G06_T7 Ruby Orange Developing Flower cDNA Library UCRCS04-UCR Citrus sinensis cDNA clone UCRCS04_008_T7_G06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CV884655 ID=CV884655|Name=CV884655|organism=Citrus sinensis|type=EST|length=907bp
GGAAAAATAAATAACTAAATTAAATATTACTCAAAAACGGATTACAATTA
CTACAGCAAAACCTATCAAGAGAGGTTAACCGAAAAAATGAGACATGTAC
ATGGTAAAAAAATACAAACAGAAACATCGACACACTGTTTCCTCAAGGAA
TTCCACAGCCTGAAAATTTCGGATGCTCAATAACTTGTGTACATGAAGGA
AATGTAACAGAACAAAACAAGTGTGGCATGAAATTTCAGCATCTATAAAT
CCTTTAGCAGGCGGTGTCTTTCCAGTGTTTGGACAGCTCAGATGAAGAGC
ACTCCAAGTGATTTTCATGAGATTGATTGGCCAGGAAAACAGAAAAGGAG
AGGAAAAGATCCTAGAGAGTAGCGAGAGAAAAGGCTCCAAGAATGCTTTA
CATGATTGATTGGTGTCAGAAAAGAGCAGAACAGAATTGTTTAGTGTCTG
ATGCACCTGATTAAGATTGATTTACATAGAGAACAGGAACTAGCCCAGCC
ATTTTGCCATCCCTTCCAGGGCGTTTCTTCTTCACATAAAACCATCCATC
CACTTCGTACTCAATCTCAACCGCTTCTCCGGCTGTCAAATTTAACTCAT
CATCTCCTCCAGCAGTGAAGTCATATAATGCTGTTCCAAATTGCTGTTTC
CCGGAAGAACTTCGCTCCGTATCTTGGGATCCATAACTATGCGAAGCAGA
CCCAGCTAATGGATTCTCAAATGACTCATACCTTTCCATAACAGGTGGTG
TGTATGGAGGAGGCTCTTCTCTTATCGTAGTTTGTGAGGACCCATAGTTG
GATGGTTTTGAACTGAACAACGAAGGGTAGTTCATTCCACCAAAGTGAGA
CGATATGGAAGTTTCAACCGATCCAGTCGAATCTGGGGAGGATGATCCAT
AGGACCT
back to top