CX043489

Overview
NameCX043489
Unique NameCX043489
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length753
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3573 contig Csv1_Contig3573:1..753. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS07_11D05_g Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-11D05-G9-1-7.g, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX043489 ID=CX043489; Name=CX043489; organism=Citrus sinensis; type=EST; length=753bp
GTTGGAACATCCGGTGAAGTGGTGGACTCGTGGCTGACCTTCGCCGTCTC
CGAACCACGCTACGATTGGTCTACTCTATAGTAGCGGAAACAACACACAA
CGCCTGAGCTGGAAAGAAAAGGCCAAAAAAAAACACTTTGTTTTCAGTTT
CACGAATTATACAATTTTTGCGGTCAGATTCGGACCATTAGTTGAATAGT
ATCGCCTCTCCTTGAAAAGCATGTCTGCAGCAGCATCAGCATTTACCTTT
AGTTTAAGCCCCAACCCATTGAATCTCACCCACTTGTTGCAAAGAAACAC
AAGTCTTATTGTTTTCAGTTCCGCTTCCACATCCATTGGTCGAAACTTAA
AGCCCCCTTCCTTAAGACGTCAATTGTTATTCGGAGTCCCCATTCCACAT
GGATCCTTCAAGCGAAGCTCCTCCATCTTCACTCCCTCAAGGCATTTTTT
CTCTCCTGTCATGGAGTGGCAGGATTGCACGGTGAAGAGTGAGATCGACG
TGCCTGTTTCAGTGGCTTACAATGCTTACTCTGATCGTGAATCAATTCCC
CGATGGATGCCATTCATTTCATCTGTAAAGATATTGGAAGACAAGCCTGA
TTTATCAAAATGGTCGCTCAAGTATAAAGCGTTCGGTCGTGATATTGAAT
TCTCTTGGCTTGCTAGAAATATGCAGCCCATTCCTAATCAGAAAATCCAC
TGGAGATCTCTTGAAGGTCTGCCTAACAGAGGTGCTGTTCGGTTTTTTCC
CAA
back to top