EY665177

Overview
NameEY665177
Unique NameEY665177
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length652
Alignments
Feature NameTypeLocationAnalysis
EY665177_ssr52 microsatellite EY665177_ssr52:52..66.
EY665177_ssr1 microsatellite EY665177_ssr1:1..12.
Properties
Property NameValue
Genbank descriptionCS00-C1-101-074-H09-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY665177 ID=EY665177|Name=EY665177|organism=Citrus sinensis|type=EST|length=652bp
GTATGTATGTATGTGTATCTATGTATGTATATGTTATGGTGTGTGCACAT
GTAATAATAATAATAATGTTTTTTCACCTGTCAATAAATTTAAAAAATAA
TTTATTTGTTTTTTAGGTTCAGTTTTTGGATTTAAAATTTAGAACCGAAA
ACTAAACTGGTAATTTTTTTGTTCTGGTTCAGTTCTGCCCCCCCTAATTT
AAACGATTAAGTATTTTCTTATTTTTGCAATAATGAGGAAATTTGGTTCT
TTAGATCCTCTCTGTATCGTCAAACAATTAATGGCACTTAATCATTGGTT
CTAGCTTTTCAACTTTTTTGTATATTGAATACAATCTCTATTTGCATCTC
TTTATTAATGAACTGTTAAATCAATTTTTGAGGTGGATAACCTATAGTAT
TAAATCAACTCAGAAGAAGTTCTATTTGAGCATTTCAGTGAANGTTGTAT
TACCTCTTATTCTTAACTATTTTTGCTGAAGAAAGTTTTATTTGGACCAA
TTTCAAGAGATATTATTATGGGTTGTCCTGATGATGAAGCATTCGTGTTC
CTGGCTAGTGTATACAGTTGCTCTCACTATACATGTCTTTGAGCACGGAA
TTTCAAGGAGCATTATAATGGAGCTCTTGTATGACAGTGTAAAATATTTA
GT
back to top